Как принимать оксандролон мужчинам: Оксандролон как принимать мужчине

Содержание

Оксандролон как принимать мужчине

Гормональный препарат Оксандролон, еще известный под торговым названием Анавар, был разработан для лечения заболеваний и состояний, сопровождающихся потерей мышечной массы. Из-за своих фармакологических свойств приобрел популярность в качестве спортивного стероида в бодибилдинге и других видах спорта, и был причислен к средствам допинга. Данное средство принимают только по назначению врача и в строгом соответствии с разработанной схемой лечения.

Что такое Оксандролон

Стероидный препарат Оксандролон (Oxandrolone) был синтезирован американской фармакологической компанией Searle Laboratories в середине прошлого века. Средство представляет собой 17α-метилированный гетероцикл дигидротестостерона (ДГТ), с атомом кислорода вместо углерода. Широкую известность оно приобрело благодаря высокой анаболической активности – ускорению синтеза белков, влияющему и на регенерацию и образование клеток тканей, органов и мышц. Производится под торговыми названиями:

Биологический эффект

Среди других лекарств группы стероидов Анавар выделяется за счет низкого андрогинного эффекта. Его активный компонент не обладает способностью к ароматизации – не конверсируется в эстрогены; токсичность для печени умеренная, анаболическая активность составляет 400% от тестостерона. При суточных дозах менее 20 мг не влияет на секрецию этого гормона, не ингибируя ось гипоталамус-гипофиз-яички, после трехмесячного курса подавляет его выработку на 67-70%.

При проведении клинических испытаний у пациентов с ожогами более 40% площади поверхности тела при приеме средства было зафиксировано улучшение состава тканей и ускорение их регенерации. Первоначально лекарство предназначалось для:

  • лечения расстройств, сопровождающихся потерей мышечной массы;
  • комплексной ВИЧ/СПИД терапии;
  • лечения остеопороза.

Из-за высокой популярности среди спортсменов-культуристов и распространения случаев злоупотребления в спортивной среде все лекарственные формы медикамента, его соли, изомеры, эфиры были отнесены в США к категории контролируемых веществ, считаются средством допинга. Лекарство относится к орфанным препаратам (средства, применяемые для лечения редких заболеваний), показывает высокую эффективность при лечении:

  • алкогольных гепатитов;
  • прогрессирующей мышечной дистрофии;
  • нарушений белкового обмена на фоне травм, ожогов, лучевой терапии;
  • синдрома Тернера;
  • потери веса у ВИЧ-инфицированных пациентов;
  • наследственного отека Квинке;
  • анемии;
  • белкового катаболизма после длительной терапии кортикостероидами;
  • остеохондроза;
  • остеопороза.

Оксандролон для сжигания жира

Основным терапевтическим эффектом медикамента является повышение рельефности и твердости мускулатуры. Наращивание мышечной массы и сжигание жира считаются показателями вторичного действия. Исследование эффекта жиросжигания в результате приема препарата проводилось производителем Анавара, в нем принимали участие мужчины старше 60 лет, не занимавшиеся силовыми тренировками.

При суточной дозировке 20 мг потеря жировой ткани за 12 недель составила 1,8 кг, при этом после прекращения курса на протяжении 3 месяцев восстановилось лишь 17% от потерянного жира. Во время исследования было установлено, что по мере жиросжигания увеличивалась чувствительность к инсулину Это означает, что организм стал способен обходиться меньшим количеством этого гормона в ответ на поступление пищевых субстратов в кровь, и риск превращения глюкозы в жир снизился.

Как принимать Оксандролон

Назначение стероидного препарата, разработка схемы применения и длительности курса производится лечащим врачом. Самостоятельное применение чревато развитием побочных эффектов и негативных последствий для здоровья организма (систематическое злоупотребление медикаментом может стать причиной, например, атрофии яичек). Во время лечения перестраивается работа эндокринной системы, поэтому после окончания курса иногда необходима восстановительная терапия с применением Тамоксифена или других препаратов, ингибирующих периферические эстрогенные рецепторы.

Средняя суточная дозировка, в зависимости от целей лечения и диагноза, составляет от 5 до 20 мг, разделяется на два-четыре приема. Во время терапии с целью набора мышечной массы пропивают Оксандролон соло либо в сочетании с другими средствами для увеличения эффективности. Рекомендуемая длительность курса составляет один месяц, проходить лечение повторно можно не ранее чем через 30–60 суток.

Женщинам

Применение гормональных препаратов группы анаболических стероидов женщинами может приводить к появлению признаков вирилизации – проявление таких «мужских черт» как огрубение голоса, рост волос на теле и лице по мужскому принципу и пр. При применении средства Оксандролон в рамках рекомендуемых терапевтических доз вирилизация практически исключена, поэтому средство безопасно для женщин, и может в редких случаях назначаться даже подросткам в случае жесткого контроля приема и соблюдения предписаний лечащего врача.

Оксандролон для девушек назначается в уменьшенной дозировке (по сравнению с «мужскими» дозами), суточная норма зависит от целей терапии и особенностей организма. Прием начинают с 5 мг/сут, каждые 7–10 дней производят небольшое увеличение суточной дозы при отсутствии побочных явлений и наличии эффекта. Длительность терапии может составлять от полутора до трех месяцев. При сбоях менструального цикла, появлении признаков маскулинизации или вирилизации, проявлениях других побочных эффектов, связанных с изменением гормонального фона, прием прекращают.

Мужчинам

Применение с целью набора мышечной массы, увеличения выносливости и силы должен производиться только по назначению врача и в строгом соответствии с его рекомендациями. Особенно это касается комбинированных курсов, когда несколько стероидных анаболических средств принимаются параллельно. Применение препарата соло производится при соблюдении следующих принципов:

  1. Продолжительность приема не должна превышать 6–8 недель, определяется индивидуально и корректируется в соответствии с ответом организма на терапию.
  2. Начинают терапию с суточной дозировки 20 мг, разделенной на две части – утром, натощак, и в первой половине дня, до обеда, спустя не менее 2 часов после первого приема.
  3. Постепенно дозировку увеличивают, в среднем на 20 мг каждую неделю. Суточная норма делится на три приема. Максимальная суточная доза не может превышать 80 мг/сут.
  4. При отсутствии побочных явлений курс продолжают на протяжении 42–56 дней.
  5. После окончания приема проходят обследование на определение уровня выработки собственного тестостерона, при необходимости – пропивают курс препарата, восстанавливающего его секрецию.

Комбинированный курс

В совместный курс, для повышения эффективности лечения и снижения таких побочных эффектов как понижение либидо, нарушения эрекции, токсическое воздействие на печень, включают другие андрогенные препараты – Сустанон, Примоболан, Гонадотропин, препараты тестостерона. Средняя суточная дозировка медикамента Оксандролон в комбинированных курсах составляет около 40 мг/сут. В рамках таких курсов происходит большее увеличение мышечной массы. Необходимо соблюдать режим спортивного питания, специальную диету.

Побочные эффекты­

Прием лекарства может вызвать ряд побочных эффектов, связанных с перестройкой работы эндокринной системы, изменением гормонального фона, индивидуальным ответом организма на терапию. Токсическое влияние средства на печень незначительно. Исследования показывают, что применение медикамента по 20 мг за сутки на протяжении 12 недель никак не влияет на уровень печеночных ферментов (показатели разрушения печени). Первыми признаками повреждения печени является боль в правом подреберье, светлый стул и темная моча. К возможным побочным явлениям относят:

  • реакции со стороны пищеварительной системы: тошнота, рвота, боли в эпигастрии, снижение аппетита, сбои в работе желудка, диарея;
  • ломоту в костях конечностей;
  • понижение либидо;
  • отечность;
  • развитие карциномы;
  • желтуху;
  • развитие атеросклероза
  • рост вероятности открытия внутреннего кровотечения;
  • со стороны нервной системы: нарушения сна, бессонница, депрессия;
  • гинекомастию (увеличение молочных желез) или уменьшение размеров молочных желез;
  • приапизм;
  • гипертрофию простаты;
  • аденокарциному предстательной железы;
  • судороги;
  • полиурию;
  • поллакиурию;
  • сбои менструального цикла у женщин;
  • явления вирилизации у женщин – понижение тембра голоса, увеличение размеров клитора, потеря волос.

Противопоказания

Лекарство не назначается при ряде заболеваний и состояний, связанных с нарушением функций простаты, печени, сбоев со стороны сердечной деятельности, эндокринной системы. К противопоказаниям к приему относятся:

  • простатит в острой или хронической форме;
  • рак предстательной железы;
  • аденома простаты;
  • рак грудных желез у мужчин;
  • беременность, период лактации;
  • сахарный диабет;
  • сердечная недостаточность;
  • заболевания печени;
  • инфаркт миокарда в анамнезе;
  • возраст до 18 лет;
  • повышенная чувствительность к компонентам препарата;
  • гиперкальциемия.

Цена Оксандролона

Продается Оксандролон в аптеках, при оформлении покупки фармацевт может потребовать предъявить врачебное назначение. Диапазон цен на разные формы выпуска лекарственного средства в московских аптеках:

Оксандролон (более известный под торговой маркой АНАВАР), а так же: Оксандрин, Анатрофилл, Васороме. В бодибилдинге имеет сленговое название “Оксана”. Данный препарат является анаболическим стероидом, который впервые был выпущен под торговой маркой Анавар в 1964г. Препарат известен благодаря тому, что имеет высокий уровень анаболической активности (400% от тестостерона), в то же время крайне низкий уровень андрогенной активности (20% от тестостерона).

Изначально оксандролон разрабатывался для лечения таких болезней:

  • ВИЧ-инфицированных больных людей
  • Анемии
  • Синдрома Тернера
  • Для восстановления после ожогов
  • Укреплений костей

Но уже через пару лет анавар стал использоваться любителями здорового образа жизни и атлетами в бодибилдинге. Оксана стала хорошей заменой альтернативному дианаболу (метану) в то время это был самый распространенный анаболический стероид. Атлеты не только занимавшиеся бодибилдингом, но и другими видами спорта, быстро оценили все преимущества данного АС ну и начали применять оксандролон на постоянной основе.. собственно тогда Анавар и был занесен в список контролируемых препаратов.

Стероидный профиль оксандролона

  • Анаболический эффект: 400% от тестостерона
  • Андрогенная активность: 20% от тестостерона
  • Ароматаза (конверсия в эстрогены): отсутствует
  • Гепатоксичность (токсичность на печень): слабая (умеренная)
  • Способ употребления: оральная форма (внутрь), т.е. таблетки
  • Длительность действия препарата: 8-12 часов
  • Время обнаружения препарата: до 45 дней

Эффекты от приема оксандролона

  • Основным эффектом оксандролона является повышать РЕЛЬЕФНОСТЬ и ТВЕРДОСТЬ МЫШЦ.
  • Сжигает жир
  • Увеличивает силу
  • Повышает уровень гормона роста

Курс анавара «СОЛО» нецелесообразно использовать на этапе набора мышечной массы. Препарат рекомендуется для тех атлетов, которые имеют приличную мышечную массу и их цель сжечь подкожный жир, приобрести рельеф, твердость мышц.

Побочные эффекты от приема оксандролона

Гепатоксичность (токсичность на печень): умеренная (слабая). Даже, несмотря на то, что препарат является альфа-17-алкилированным стероидом. Как показали исследования, прием анавара в сутки в дозировке 20 мг, на протяжении 12 недель никак не повлиял на уровень печеночных ферментов (это показатели разрушения печени).

Но в случае чего вы должны знать первые признаки повреждения печени: светлый стул, темная моча, боли в правом подреберье.

Оксандролон не конвертируется в эстрогены, т.е. такие побочные эффекты как: гинекомастия, задержка воды, акне (прыщи), отложения по женскому типу и т.д. отсутствуют.

Оксандролон в меньшей степени оказывает влияние на уровень выработки собственного тестостерона (я бы сказал даже не оказывает значительного влияния) но это если не злоупотреблять, т.е. в умеренных дозах препарат не угнетает ось гипоталамус-гипофиз-яички. А вот когда дозировки Анавара высокие, то организм реагирует на это снижением продукции гонадотропина, думая, что эндогенный уровень тестостерона слишком высокий. Отсутствие стимуляции клеток Лейдига приводит к атрофии яичек.

В свою очередь подавление выработки собственного тестостерона проявляется снижением ЛИБИДО и вялой эрекцией. Но с этим можно бороться добавив в курс ГОНАДОТРОПИН либо просто напросто делать комбинированный курс с андрогенными препаратами.

Очень редко, но все же иногда встречаются такие побочные эффекты от приема Анавара:

  • Снижение аппетита
  • Тошнота
  • Боли в животе
  • Головные боли
  • Подъем артериального давления

В принципе побочные действия встречаются очень редко, посему препарат является одним из самых безопасных анаболических стероидов.

Оксандролон: КУРС “СОЛО”
  1. Курс подойдет тем атлетам, которые желают повысить рельефность, твердость мышц.
  2. В то же время важно проконсультироваться с врачами, дабы выявить возможные противопоказания (например, заболевания печени, гипертрофия простаты и другие).
  3. Длительность курса: 6-8 недель.
  4. Дозировки начинаются с 20 мг в сутки. Разделите на два приема (утром и в начале второй половины дня). Через неделю увеличьте дозировку до 40 мг в сутки (максимум до 80 мг не более). Разделите на три приема (утром, в обед и вечером).
  5. Через 2 дня после окончания вашего курса начинайте принимать Тамоксифен в дозировках 10 мг в сутки (дабы восстановить собственный выработок тестостерона) и так 1-2 недели (по 10 мг в сутки).
Комбинированный курс

Комбинирование помогает снизить побочные эффекты оксандролона (а именно, побороть снижение либидо, вялую эрекцию, токсичное влияние на печень) и побочные эффекты прилагаемых ниже препаратов:

Комбинирование препаратов может быть не только с целью получить рельеф мышц, но и увеличить мышечную массу.

Например (вот вам курс):

Анавар 50мг в день + тестостерон пропионат 400 мг в неделю + 400 мг тренболона ацетата в неделю. Длительность такого курса от 6 до 8 недель. После чего нужно провести РСТ (ПКТ) послекурсовую терапию. При такой связке вы будете наблюдать рост качественной мышечной массы.

Оксандролон – препарат, обладающий рядом преимуществ перед аналогами, широко применяющийся атлетами разного уровня, а также распространен среди спортсменок, из-за его минимальных побочных эффектов. Единственной альтернативой данного препарата считается мастерон, который выпускается как в оральной, так и в инъекционной форме. Оксандролон – это стероид, выполняющий задачи на заключительном этапе предсоревновательного периода в бодибилдинге, или препарата так называемого «моста», когда организм спортсмена восстанавливается после стероидного курса, и убирает феномен отката.

Стероидный профиль

Оксандролон имеет выраженный перевес в анаболическую сторону. Андрогенные эффекты снижены, за счёт этого побочные эффекты сведены к минимуму, как и прирост мускулатуры.

Эффекты от употребления

Препарат был изобретён в Соединённых Штатах на заре золотой эры бодибилдинга, однако, применялся он сугубо в медицинских целях. Его профиль действия обширен. Интересен тот факт, что лекарственные дозы гормонального средства были высоки в сравнении с другими стероидными лекарственными средствами. Так, например, суточная доза метандростенолона, указанная в инструкции, не превышает 5 мг. В сутки, максимальная суточная доза оксандролона равна целым 20 мг. В мире спорта дневная пиковая дозировка стероида равна 40 мг. А дозировка метана может достигать 60 мг.

При тестировании оксандролона была выявлена оптимальная длина приема, при которой анаболические эффекты достигали максимального уровня, а негативное влияние не росло. Опыты показали, что короткие четырех-шести недельные курсы являются оптимальным вариантом, а превышение этих сроков не увеличивает нужных для спортсменов эффектов, но повышает риск появления побочных эффектов.
Ещё одним свойством препарата является мощное повышение иммунитета.

Oxandrolone Соло

Курс оксандролона не должен превышать шести недель. Пиковой, максимальной и оптимальной суточной дозой считается 40 мг. При построении стероидного курса следует делать ступени, длиной в пять дней. Первая ступень – 10 мг. Вторая ступень – 20 мг. И так далее до четвертой ступени, которая составляет 12 дней, когда атлет принимает максимальную дозу 40 мг. После этой ступени курс начинает завершающую стадию, происходит снижение дозировки симметрично первым трем ступеням.

Суточную дозу оксандролона следует делить на два или три приема. Начинать курс нужно с утреннего приема, на второй ступени добавляем ещё один прием с промежутком в шесть часов, и так далее. Дозу можно разделить и на четыре приема, однако, последний прием в сутки не должен быть позднее восьми вечера. Так как препарат действует длительное время – до 12 часов, лучшим вариантом будет употребление стероида утром и в обед. Каждую дозу лучше употребить за 10 минут до еды.

При использовании нормальных анаболических средств, рацион атлета должен быть сбалансированным, и насчитывать не менее двух грамм белка на 1 кг веса. Несмотря на то, что этот препарат не создан для набора массы, при правильной диете и грамотно построенной тренировке спортсмен способен получить до четырех килограмм сухой, рельефной мускулатуры. Препарат отлично подойдёт спортсменам, имеющим конституцию по типу мезоморфа, так как обладает сильным жиросжигающим эффектом, при котором не выгоняет воду, не вредит суставам и связкам, как станозолол или туринабол.

Комбинированные курсы

Оксандролон и Мастерон

При использовании препарата в комплексе с другими средствами следует выбирать стероиды, направленные на создание сухой, качественной мускулатуры.

Одним из лёгких и эффективных комплексов будет Оксандролон и инъекционный Мастерон. Подобный вариант позволит создать качественную форму при минимальном риске побочных эффектов и вреде организму. Оба препарата в данной связке хорошо дополняют друг друга, и при минимальных дозах дадут мощный синергический эффект. На таком курсе, длиной в 40 дней, атлет может получить 6 кг безупречной мускулатуры.
Курсы с препаратами, имеющими высокие андрогенные эффекты, направленные на увеличение массы в комплексе с оксандролоном не дадут хорошего результата.

Во-первых, оксандралон не способен дать прирост массы, как другие препараты, например, метандиенон или станозолол, в случае, если нужно набрать большую, но качественную массу. Во-вторых, цена оксандролона в несколько раз выше, чем у того же станозолола.

Курс сустанона, или других длинных эфиров тестостерона, с оксандролоном не даст желаемого результата, а вот оксандролон и тестостерон пропионат будет отличным вариантом для набора сухой рельефной мускулатуры, или удержания ее в промежутке между полноценными стероидными курсами из четырех или шести препаратов. Данный курс составляется то принципу пирамиды, описанной выше. Пропионат нужно ставить по 1 мг через день с утра.

Как принимать оксандролон женщинам

Препарат принимается три раза в сутки по схеме пирамиды, однако, каждая ступень увеличивает дозу от 2,5 до 5 мг. Максимальной суточной дозировкой является 20 мг. Профессиональные атлетки, выступающие на соревнованиях по бодибилдингу, применяют комплекс из оксандролона и мастерона в средних дозах по 10 мг в сутки. Любой, комбинированный или соло, курс стероида не должен превышать 4 недели. После четырехнедельного перерыва с учётом ПКТ, курс можно повторить.

Возможные побочные эффекты

Как и другие оральные стероидные препараты, Оксандролон проходит два круга по кровеносной системе и метаболизируется в печени, что увеличивает нагрузку на сам орган и организм в целом. У женщин, от длительного приема гормонального средства, существует большой риск вирилизации. В подавляющем большинстве, у всех спортсменок нарушается менструальный цикл уже после первого курса оксандролона. У мужчин крайне редко встречается снижение выработки собственного тестостерона.

Крайне редко спортсмены жалуются на тошноту, рвоту, диарею, боль в животе и другие проблемы со стороны ЖКТ.

Также, крайне редко случаются аллергические реакции, повышается кровоточивость.

Возможны депрессии и нарушение сна. У мужчин есть риск развития аденомы и аденокарциномы предстательной железы, уплотнения молочной железы, гинекомастия, угнетение сперматогенеза.

Анавар в аптеке

Препарат продается в аптечной сети. Выдаётся по рецепту, так как относится к сильнодействующим гормональным препаратам. Анавар (Оксандролон) из-за своей высокой стоимости является часто подделываемым лекарственным средством.
Фармакологические компании, которые производят Анавар

  • Euro Prime Farmaceuticals (Молдова)Anavarged.
  • Oxandrolone Bayer, производитель: Bayer Schering Pharma (Германия).

Оксандролон или станозолол – что лучше?

Из плюсов станозолола можно отметить больший прирост мышечной массы и низкую цену. Длительность приема станозолола может быть больше на две недели. Однако есть ряд недостатков, например, препарат сильно снижает водный баланс в организме, тем самым увеличивает риск получения тяжелых травм во время тренировочного процесса. В остальном, все побочные эффекты станозолола выражены сильнее, а при использовании Анавара, вред можно сократить к минимуму. При соблюдении доз и срока приема, ПКТ можно провести, используя минимум средств.

Оксандролон или мастерон?

Два препарата, которые оказывают мощный синергический эффект при их сочетании во время сушки. По отдельности, это два разных по действию средства, но направленных на получение плотной и рельефной массы тела.

Отзывы о стероиде Анавар

«Анавар отлично работает, постепенно увеличивая эффекты жиросжигания, при этом, не оказывая сильного диуретического действия. При курсе соло можно не прибегать к применению средств ПКТ. Достаточно короткого двухнедельного перерыва, после которого можно начинать следующий курс».

«Препарат в кратчайшие сроки в несколько раз увеличил мускулатуру и уменьшил общую жировую ткань на 6%. Такой эффект получился за три недели приема».

ОКСАНДРОЛОН ОТЗЫВЫ МУЖЧИН отзывы врачей отрицательные и реальные, развод или правда, цена в аптеке на 2022 01:21

Доброй ночи дорогие читатели моего отзыва. Хочу сегодня поделиться с вами впечатлением о том, чем увлекся мой муженек в последнее время — накачаться так, чтобы все вокруг него только и делали, что ахали, а конкретнее — препарат Оксандролон. Теперь расскажу краткую историю о том, как вообще появился этот препарат у нас дома, и что это вообще такое.

Мой муж — заядлый спортсмен, его интересует только спорт, и поэтому работает, как вы, я думаю, догадались, тренером в тренажерном зале. На вид он просто Скала — огромный, мускулистый, широкий — ну все как положено. Мне приходится его ревновать, поскольку к нему же не только мужчины ходят, но и молодые девушки. А он очень высокий, статный, да еще и качается — кто о таком не подумает и не засмотрится? Разве что той, кому вообще на мужчин все-равно. А он еще подливает масло в огонь, рассказывает, кто к ним туда ходит, какие у них попы и груди — в общем, такое ощущение, что меня специально провоцируют. Когда мы поженились еще того, давно — то он был худенький, но достаточно мускулистый. Он был красавчиком всегда, если честно уж говорить. Я -то тоже сама ничего на вид, и мужчины на меня обращают внимание, но как вы понимаете, мне нужен только он и все. Ну ревность -ревностью, а то, что он в определенный момент начал просто заниматься тем, что сначала он ходил в зал, просто для себя позаниматься, чтобы фигура красивая была, чтобы мне еще больше нравиться, да и для здоровья полезно. А потом он вообще как будто на этом помешался — начал ходить все больше и больше в тренажерку, потом вообще ему придумалось участвовать в соревнованиях, это был его первый конкурс «Мистер Олимпия» вроде. Я тогда не знала, что нас ждет впереди, и наступил тот момент, что он берет и уходит со своей работы, а потом устраивается на работу тренером в тренажерку. Я была просто в ярости, как он мог так со мной поступить, при этом не посоветовавшись. Еще одним моим поводом для недоумения стало то, что я начала у нас дома, особенно в его куртках замечать странные таблетки — они, как оказалось, были и стероидами, и анаболиками — я специально гуглила эти таблеточки. Потом , когда я у него спросила все-таки, что это, он мне поначалу вообще врал, что это спортивные витамины, и это не то, что я могла подумать. Но я — то знала правду, и потом заставила все — таки рассказать мне о том, зачем ему это все нужно. Он мне сказал, что хотел быть очень огромным, красивым и сильным, потому что это его цель. Но естественным путем этого можно вообще не достичь, а тут на тебе — кушаешь таблетки, и при этом становишься красавчиком. С того момента он мне рассказывал все и больше не врал о таблетках.

Этот препарат появился в его жизни достаточно давно. Он как — то вообще странно себя вел, когда начал принимать этот препарат. Чтобы вы понимали, это — стероид, при чем тот стероид, который непосредственно приводит к тому, что человек начинает так сказать, сжигать жировые отложения, то есть ему это средство нужно было для сушки тела. Он кушает у меня прилично, поэтому вместе с мышцами жирок иногда виднелся. Но знаете, я вам скажу, что этот препарат достаточно опасный, чтобы его применять. Он действует на печень, при чем нормально так действует — она у мужа иногда от этого препарата побаливает — и это не шутки. Конечно, мышечную массу он конечно же прибавляет, при этом не оставляет жирка того , но! Никакой рельеф и твердость мышцы не компенсирует то упущенное здоровье, которое было угроблено вами же по глупости. Если же кому-то массу и надо набрать, то этот стероид точно не подойдет, поскольку даст он эффект совершенно обратный. Если же его принимать бездумно, то можно вообще получить атрофию яичек — да-да, именно так. И аккуратно принимать, там каждая доза должна быть согласована с доктором -это все мониторится, самостоятельно принимать вообще нельзя. Пока мой муж принимает, то выглядит хорошо, но вот здоровье начинает шалить. Рекомендую вообще не прибегать к таким препаратам, все равно рано или поздно это скажется на здоровье.

Перед применением обязательно проконсультируйтесь со специалистом


Видео обзор

Все(5)

Оксандролон в бодибилдинге — StudioRC

Опубликовано StudioRC в

Было обнаружено, что оксандролон защищает мышечную массу от некоторых заболеваний, связанных с диабетом, он способствует росту мышц и имеет высокий показатель эффективности. Стоит ли удивляться, что он оказался в мире бодибилдинга? Вскоре после того, как Оксандролон появился на медицинском рынке, он начал появляться в спортивных залах Соединенных Штатов в 1980-х годах. Учитывая его низкие андрогенные свойства и высокий анаболический эффект, он был популярным выбором для тех, кто готовился к соревнованиям.

Дозировки и циклы для оксандролона

Говоря о дозировках, какова правильная дозировка Оксандролона? Вот часто используемые дозировки и циклы для Оксандролона, но мы не рекомендуем их. Почему? Эти вещества представляют некоторый риск для здоровья, так что перед приобретением стоит проконсультироваться со специалистом.

Дозировка Оксандролон

В зависимости от опыта пользователя, массы тела и целей, уровни дозировки будут варьироваться:

  • Мужчины: от 30 до 80 мг в день
  • Женщины: от 5 до 15 мг в день

Мы видели дозировки до 100 мг в день для мужчин и 20 мг в день для женщин, но это не очень распространено. Чем выше доза, тем больше вероятность возникновения побочных эффектов и проблем со здоровьем.

Оксандролон имеет период полураспада от 8 до 10 часов, поэтому дневная доза должна быть разделена между двумя порциями. Например, если вы принимаете 30 мг в день, вы будете принимать 15 мг утром и 15 мг вечером.

Оксандролоновый цикл

Типичный цикл оксандролона длится шесть недель, после чего следует постциклическая терапия, добавка, которая используется для устранения повреждения печени и запуска тестостерона. Имейте в виду, что даже лучшие добавки после цикла лечения (РСТ) не всегда работают, чтобы устранить ущерб.

Оксандролон результаты

Настоящий Оксандролон — материал медицинского назначения — не дешевый. Он может нанести некоторый удар по вашей печени и другим органам. Итак, стоит ли оно того? Есть три основных области, которые пользователи Oxandrolone называют в качестве точек, где они видят самые значительные выгоды:

  1. Рост мышц: это данность. Оксандролон был создан специально для защиты мышц от разрушения, а также для того, чтобы организм набирал больше. Главная причина, по которой люди принимают Оксандролон, — это видеть большие мышцы.
  2. Сушка: Оксандролон также популярен во время периода сушки, поскольку считается, что при более низких дозировках он способствует увеличению размера без объемного или раздутого вида.
  3. Потеря жира: Продолжая с пунктом выше, другая причина, что Оксандролон принимается во время периода сушки, из-за его способности способствовать потере жира. При исследовании данного препарата, пожилые мужчины теряли вес и не прибавляли в весе после использования Оксандролона.

Риски и побочные эффекты

Как и все анаболические стероиды, ваш организм должен будет платить определенную цену, когда вы принимаете Оксандролон; тем более, если вы злоупотребляете этим препаратом. Наиболее распространенные побочные эффекты Oxandrolone могут включать в себя следующее:

  • Прыщи
  • Потеря либидо
  • Агрессия или чрезмерное возбуждение
  • Бессонница
  • Подавление тестостерона
  • Изменяет уровень холестерина, повышая риск сердечно-сосудистых заболеваний, таких как сердечный приступ

Если ваша цель — мышечная масса, то стоит попробовать Оксандролон, так как он буквально создан для мышц. Однако не романтизируйте этот стероид и отнеситесь к его приему осторожно. К счастью, стероиды купить сейчас не так уж сложно. В любом случае, когда речь идет о наращивании мышечной массы, такого рода препараты могут быть просто незаменимыми.

Клинические исследование Unspecified Adult Solid Tumor, Protocol Specific: Megestrol Acetate, Оксандролон 20 мг — Реестр клинических исследований

Приемлемость

Критерии:

КРИТЕРИИ ВКЛЮЧЕНИЯ: — Возраст > 18 лет без ранее существовавших или неконтролируемых медицинских или психологических заболеваний которые нарушили бы способность пациента дать информированное согласие или завершить протокол терапии или опросники качества жизни. — Минимум один месяц запланированной химиотерапии, оставшийся на момент Оксандрина или Начат прием мегестрола ацетата. Пероральные химиотерапевтические препараты, биологические препараты и моноклональные препараты. антитела включены в критерии приемлемости. — Гистологически подтвержденная солидная опухоль (см. исключения в списке исключений) — Пациентки женского пола с раком молочной железы, гинекологическим раком и гормональными нарушениями в анамнезе. реагирующие опухоли зародышевых клеток должны быть свободны от болезней в течение > 5 лет, чтобы иметь право на это изучать — Пациенты с немеланомным раком кожи и карциномой in situ шейки матки имеющий право. — История потери веса: 1.> 5% от общей массы тела в течение предыдущих 6 месяцев ИЛИ 2.> 3% в предыдущем месяце ИЛИ 3. Прогрессирующая потеря веса за 2 визита подряд, несмотря на попытки диеты, поведенческие или фармакологические вмешательства. — Статус производительности ECOG 0-2 — Ожидаемая продолжительность жизни > 6 месяцев — Креатинин сыворотки < 2,5 мг/дл, SGOT и SGPT < 2 раза выше верхней границы нормы, общий билирубин < 2,5 мг/дл — Пациенты должны быть в состоянии проглотить 1 таблетку два раза в день или 20 мл жидкости каждый день. — Пациенты должны иметь возможность удовлетворять свои потребности в питании перорально с помощью пища и / или пероральные добавки или через энтеральное зондовое питание. Однако таблетки Оксандрина необходимо вводить перорально. — Пациенты, принимающие варфарин для поддержания проходимости центрального венозного катетера имеют право на участие в этом испытании, если их МНО < 1,2. Из-за взаимодействия между варфарин и оксандрин, поддерживающая доза варфарина у подходящих пациентов должна быть вдвое, чтобы сохранить МНО на уровне 1-1,2. Например, если пациент принимает 1 мг варфарина при включении в исследование рекомендуется снизить дозу до 0,5 мг в сутки. дозу следует снижать до раз в два дня, каждый третий день и т. д., чтобы поддерживать МНО на уровне < 1,2. МНО следует проверять еженедельно, пока оно не стабилизируется на уровне < 1,2. — Пациенты могут получать одновременную лучевую терапию. КРИТЕРИЙ ИСКЛЮЧЕНИЯ: — Текущее или запланированное лечение кортикостероидными препаратами, эстрогенами, прогестинами (включая мегестрола ацетат) или любой другой стероидный гормон в течение периода исследования. Пациенты, которые получают прерывистые кортикостероиды как часть прехимиотерапии режим противорвотных средств подходит для этого исследования. Пациенты, получавшие оксандрин или Мегестрола ацетат менее чем за 3 месяца до включения в исследование не допускается. Пациенты, принимающие дронабинол или любой другой стимулятор аппетита не должны приниматься в течение как минимум 3 дней до начала приема исследуемого препарата. — Пациенты, у которых было следующее, не имеют права: — Рак простаты — Рак молочной железы у мужчин — Опухоли женской молочной железы, гинекологические или гормонально чувствительные зародышевые клетки за последние 5 годы — Первичные или метастатические злокачественные опухоли головного мозга, которые не были стабильными или не демонстрировали прогрессирование заболевания в течение последних 6 мес. — Лейкемия, лимфома, миелома или другие гематологические злокачественные новообразования — Мужчинам старше 40 лет следует проверять уровень простатспецифического антигена (ПСА), если не наблюдалось в течение последнего года. Пациенты с уровнем ПСА > 4 нг/мл будут исключены от участия в исследовании. При необходимости ПСА следует провести в течение 2 недель до регистрации. — Пациенты с гиперкальциемией, нефрозом или нефротической фазой нефрита или неконтролируемая артериальная гипертензия, застойная сердечная недостаточность, отек легких, нестабильная стенокардия или синдром Кушинга. — Пациенты с недавним (в течение 6 месяцев) активным тромбоэмболическим заболеванием или недавним инфаркт миокарда (в течение 3 месяцев после включения в исследование). — Системная антикоагулянтная терапия: пациенты, которые в настоящее время принимают пероральные антикоагулянты (варфарин), не имеют право, если они не принимают низкие дозы варфарина для проходимости катетера. Если у пациента развивается тромбоэмболическая болезнь во время лечения, они могут остаться в исследовании. Рекомендуется, чтобы они получили стандартную нагрузочную дозу кумадина в 1-й день. из-за взаимодействия между Оксандрином и Кумадином (Оксандрин повышает МНО), пациентам впоследствии потребуется гораздо более низкая доза кумадина. комбинированные препараты должны развиваться в течение 24–48 часов. Рекомендуемый кумадин дозу следует уменьшить до 20% от того, что обычно требуется для достаточного антикоагулянты. (Пример: если пациент обычно получает 5 мг каждый день, они следует принимать только 1 мг каждый день.) Следует часто контролировать результаты ПВ/МНО. с корректировкой дозировки по мере необходимости. — Значительный асцит, плевральный выпот или отек, которые могут препятствовать пероральному приему пищи или признать недействительными определения веса. — Диабетические препараты разрешены, однако пациенты, принимающие сульфонилмочевину, не имеют права. Ниже приведен список часто используемых сульфонилмочевины (Примечание: это полезное руководство, а не полный список.): глимепирид (амарил®), глибурид (диабета®), хлорпропамид (диабинезе®), глипизид (Glucatrol®), комбинированный глибурид и метформин (Glucovance®) и ориназа (Толбутамид®). Нет противопоказаний для одновременного применения инсулина и оксандролона (Оксандрин®), если требуется пациенту. Любой пациент, принимающий инсулин или другие пероральные гипогликемические средства, должен самоконтроль для предотвращения гипо- и гипергликемии. — Пациенты, которые беременны или кормят грудью. — Пациенты с историей приапизма (постоянной эрекции) и серповидно-клеточной анемией. — Пациенты с ИМТ (индекс массы тела) ≥ 35 .

Пол:

Все

Минимальный возраст:

18 лет

Максимальный возраст:

Н/Д

Здоровые волонтеры:

Нет

Пивные дрожжи для набора веса: как принимать

Пивные дрожжи: Mamapedia.com.ua

Диетологи рекомендуют употреблять пивные дрожжи для набора веса взрослым и детям. Рассмотрим, что это за вещество и чем оно полезно.

Пивные дрожжи: что это такое, как принимать для набора веса

Пивные дрожжи относятся к биологически активным добавкам.

Средство назначают для улучшения обмена веществ, общего укрепления организма, нормализации веса у детей и взрослых.

Дозировка следующая:

  • дети 3–12 лет — по 1–2 таблетки три раза в день;
  • дети с 12-ти лет и взрослые — по 2–4 таблетки три раза в день.

Пивные дрожжи — это совокупность грибковых микроорганизмов, которые обеспечивают брожение. Их используют для того, чтобы готовить натуральное живое пиво. Отсюда и название.

Открыв их целебные свойства, в фармакологии разработали безалкогольные средства из дрожжевых грибов.

Препараты существуют в таких формах:

  • живые жидкие;
  • порошкообразные или гранулированные;
  • пивные дрожжи в таблетках.

Последний вариант распространенный и простой в применении. Таблетки имеют доступную цену, продаются в любой аптеке.

Порошок или гранулы встречаются редко, а в жидком виде найдете их разве что на пивзаводе, причем срок годности таких пивных дрожжей не более 12 часов.

Фото: domadoktor.ru: UGC

Пивные дрожжи целенаправленно не наращивают жировую прослойку или мышечную ткань.

Они обеспечивают организм важными микроэлементами для нормализации жизнедеятельности.

Соответственно, улучшается сон, аппетит, стабилизируется метаболизм. Поэтому люди с низким коэффициентом массы тела поправляются.

Самостоятельно назначать себе БАД не стоит. Проконсультируйтесь с доктором, изучите противопоказания.

Пивные дрожжи: польза и вред, противопоказания

В пивных дрожжах есть витамины группы В, а также РР, Е, С, F, D, различные минеральные добавки (кальций, цинк, магний, селен), аминокислоты и жирные кислоты, в которых зачастую нуждаются люди с недостаточным весом.

Грибы положительно действуют на организм, а именно:

  1. Укрепляют иммунитет.
  2. Налаживают работу ЖКТ, активируют ферменты, возбуждают аппетит.
  3. Ускоряют липидный, углеводный, белковый обмены.
  4. Обеспечивают регенерацию и рост мягких тканей.
  5. Укрепляют нервную, эндокринную и сердечно-сосудистую системы.
  6. Используются для лечения и предупреждения заболеваний печени, кожи, ногтевых пластин и волос.
  7. Восстанавливают организм при авитаминозе, физическом или эмоциональном истощении.
Фото: Клиника Клеопатра: UGC

Доказано, что пивные дрожжи облегчают состояние людей, которые страдают от диабета, гипертонии и атеросклероза. Биологически активную добавку рекомендовано употреблять осенью и весной, когда организму не хватает витаминов и атакуют вирусы.

Несмотря на ряд полезных свойств, пивные дрожжи можно употреблять не всем. Противопоказания следующие:

  • возраст до трех лет;
  • болезни почек;
  • аллергическая реакция на препарат;
  • кандидоз;
  • расстройство пищеварения;
  • наследственные глазные болезни;
  • подагра;
  • преклонный возраст.

Нет точных данных о реакции на пивные дрожжи ребенка в утробе и грудничка. Поэтому беременным и кормящим женщинам грибы обычно не назначают.

Пивные дрожжи — натуральная витаминная добавка, которая нормализует физиологические процессы организма, способствует набору достаточного веса.

Незаменимые аминокислоты в составе дрожжей стимулируют рост мышечной ткани. Если употребление добавки подкрепите физическими нагрузками, то результат непременно порадует.

Внимание! Материал носит ознакомительный характер. Не следует прибегать к описанным в нем методам без предварительной консультации с врачом.

Автор: кандидат медицинских наук Анна Ивановна Тихомирова

Рецензент: кандидат медицинских наук, профессор Иван Георгиевич Максаков

Оригинал статьи: https://www.nur.kz/food/healthy-eating/1731384-pivnye-drozzi-dla-nabora-vesa-kak-prinimat/

9. Оксандролон / Анавар

ФОТОГРАФИИ ПРЕПАРАТА

Действующее химическое вещество: оксандролон

Торговые названия:

  • Оксандролон SPA; табл. по 2.5 мг; SPA, Италия

  • Анавар; табл. 5 мг; Hubei Huangshi Nanshang Co., Ltd., Китай

Оксандролон появился в США в 1964г. под названием Анавар фирмы «Serl». Свыше двух десятилетий пользовался огромной популярностью пока, 1 июля 1986 года американцы прекратили производство препарата. К счастью, другие фармацевтические компании не дремали и сегодня препарат продолжает производится под различными названиями. Оксандролон SPA фирмы «SPA Milano» из Италии и Анавар от Hubei Huangshi Nanshang Co., Ltd — вот, пожалуй, и всё, что можно сейчас найти на российском рынке.

Оксандролон в разумных дозах не дает никаких побочных явлений. Это и понятно, т.к. препарат изначально предназначен для женщин и детей. Это один из немногих стероидов, который не вызывает преждевременной задержки физического развития у детей, т.к. он не способствует закрытию эпофизных соединений, поэтому препарат применяется, главным образом, у детей для стимуляции роста тела и у женщин — при остеопорозе. Препарат вызывает (если вообще вызывает) очень слабые явления маскулинизации. Это качество делает его любимым средством атлеток, т.к. при дозе 10-15 мг в день у них крайне редко наблюдаются внешние проявления мужественности. Оксандролон очень любят спортсмены бодибилдинга и пауэрлифтинга.

В первую очередь это связано с тем, что он способствует сильному росту силы. Это связано с тем, что возбуждается синтез креатин фосфата в мышечной клетке и при этом не накапливается жидкость. Штангисты и силовики, которые не хотят переходить в более высокую категорию пользуются этим, т.к. препарат дает им возможность стать сильнее, не прибавляя в собственном весе.

Хорошие результаты дает одновременный прием Оксандролона и 120-140 мкг Кленбутерола в день. Хотя сам Оксандролон и не способствует заметному росту мышц, но заметно усиливает воздействие многих стеройдов на организм, особенно хорошо комбинируется с Дека-Дураболином, Дианаболом и различными вариантами тестостерона, т.к. возникающий при приеме Оксандролона прирост силы при одновременном приеме Дека-Дураболина, Дианабола или тестостерона которые накапливают жидкость и способствуют сильному росту ткани, результатом является дополнительная мышечная масса. Сочетание из 200 мг Дека-Дураболина в неделю, 500 мг тестостерона энантата в неделю и 25 мг Оксандролона в день вызывает у большинства атлетов хороший прирост силы и массы. Дека-Дураболин обладает выраженным анаболическим действие и стимулирует синтез протеинов, Оксандролон повышает силу, а тестостерон делает атлета более агрессивным во время тренировок и ускоряет регенерацию.

Вторая причина, по которой так любят Оксандролон, в том, что этот препарат не ароматизируется ни при какой дозе. Как уже упоминалось, определенная часть находящегося в крови тестостерона превращается в эстрогены. Этот процесс ароматизации по разному выражен у разных атлетов в зависимости от предрасположенности к нему. При Оксандролоне мускулатура никогда не приобретает водянистого вида, что позволяет считать препарат хорошим средством при подготовке к соревнованиям. В этой фазе, прежде всего, важно держать уровень эстрогенов на более низком уровне, т.к. эстрогены программируют организм, даже при низкокалорийной диете, на скопление воды.

В сочетании с диетой Оксандролон помогает сделать мускулатуру твердой и упругой. Хотя сам он не разрушает жиры, он все же играет в этом косвенную роль, т.к. данное химическое вещество подавляет у многих атлетов аппетит. Оксандролон может вызвать что-то вроде ощущения тяжести в желудке, что вызывает у некоторых атлетов дурноту и рвоту, если таблетки приняты во время еды. В инструкции по применению итальянского Оксандролона препарату приписывается влияние на деятельность желудочно-кишечного тракта. Поэтому некоторые атлеты и говорят о регулярных поносах. Хотя это и не очень приятное явление, это все же помогает атлету в его намерении растопить жир и выглядеть более поджарым. Те, кто тренируются для соревнований либо интересуются приростом качественной мускулатуры, должен комбинировать Оксандролон с такими стеройдами как Винстрол, Параболан, Мастерен, Примоболан и тестостерон пропионат. Сочетание из 50 мг Винстрола через день, 50 мг Тестостерон пропионата каждые два дня и 25 мг Оксандролона ежедневно показало себя здесь очень эффективным.

Еще одно преимущество способности Оксандролона к неароматизации, в том, что атлеты, которые страдают повышенным кровяным давлением при сильных андрогенных стеройдах либо заполучают из-за них гинекомастию, с этим препаратом не будут иметь никаких проблем. Сочетание Оксандролона с Дека-Дураболином является для этой группы спортсменов желательной альтернативой, если есть проблема со здоровьем при применении тестостерона, Дианабола или Анаполона50. Атлеты старше 40 должны использовать преимущественно Оксандролон.

Третья причина, говорящая в пользу Оксандролона в том, что это химическое вещество далее в очень высоких дозах не оказывает влияния на выработку собственного тестостерона. Пояснение: Оксандролон не подавляет выработку гормонов в организме. Дело в том, что он не оказывает негативного влияния на дугу гипоталамус-гипофиз-яички, т.е. при его приеме яички не сигнализируют гипоталамуса о необходимости снижения и полном прекращении выброса гормона, высвобождающего гонадотропины и лютеинизирующий гормон, как это происходит при приеме большинства анаболических стеройдов. Это особое положение Оксандролона легко объясняется тем, что его действующее химическое вещество не ароматизируется в эстрогены, т.к. как пишет доктор Мауро Г. де Паскале в своей книге «Побочные явления анаболических стеройдов — Факты, Вымыслы и Лечение» на стр.23: «предполагается, что эстрогены возникающие при ароматизации тестостерона и других анаболических стеройдов в отделах мозга и гипоталамуса, снижают секрецию лютеинизирующего гормона, а, следовательно, и выработку тестостерона». Американский врач, доктор Роберт Керр подтверждает это в книге «Практическое применение анаболических стеройдов атлетами», где на стр. 32 написано: «Если давать Оксандролон (Анавар) здоровому мужчине в высоких дозах, то в этом случае он не снижает ни количества семени, ни количества спермы и вовсе не превращается в эстрогены. Поэтому Гудманн и Гильманн сделали из этого заключение, что механизм обратной связи активизируется скорее концентрацией эстрогенов, нежели количеством тестостерона»

Поэтому Оксандролон легко комбинируется с Андриолом, т.к. Андриол в дозе до 240 мг в день не ароматизируется и выработка организмом гормонов ни в коей мере не затрагивается. Ежедневный прием 280 мг Андриола и 25 мг Оксандролона дают хорошие результаты в приросте силы, а у новичков в стероидных курсах и мышечной массы без чрезмерного водонакопления, а также без значительного воздействия на выработку собственного тестостерона. Что касается Оксандролона, то 8-12 таблеток в день мужчинам и 5-6 женщинам, кажется, приносят хорошие результаты. Легкое правило ежедневного приема 0.25 мг препарата на килограмм веса оправдало себя на практике, таблетки, как правило, принимают 2-3 раза в день сразу после еды, и т.о. достигается оптимальная резорбция (оптимальное всасывание) препарата, его действующего химического вещества. Те, у кого же возникают при приеме препарата желудочно-кишечные расстройства, поступают верно, принимая таблетки через час — два после еды или вообще отказываются от него. Т.к. Оксандролон мало токсичен и едва ли вызывает побочные явления, его принимают многие атлеты и долгий промежуток времени. Но не стоит применять его несколько месяцев без перерыва, т.к. он, как почти все оральные стеройды, алькулирован по 17-альфа и представляет собой нагрузку на печень. Оксандролон — средство широкого спектра воздействия, которое применяется разносторонне и в зависимости от цели атлета. Женщины с чувствительной реакцией на анаболические стеройды достигают хороших результатов с комбинацией Оксандролон + Примоболан S» и/или Кленбутерол, они не страдают, при этом явлениями маскулинизации. И все же женщины не должны принимать препарат в дозе более 6 таблеток в день, т.к. в противном случае могут возникнуть обусловленные андрогенами побочные эффекты в виде окне, ломки голоса, снижение тембра голоса, гипертрофия клитора и усиленного выпадения полос.

Оксандролон » Спорт в Краснодаре

Торговые названия:

Анавар /снят сп-ва/ 2.5 мг табл.;
Анатрофилл /снят/ 2.5мг табл.;
Липидекс 2.5 мг табл.;
Лонавар /снят/ 2.5 мг табл.;
Оксандролон SPA 2.5 мг табл.

Оксандролон появился в США в 1964 году под названием «Анавар» фирмы «Серл». Это мягкий стероид с очень слабым андрогенным компонентом. Выяснилось, что Оксандролон в разумных дозах не дает никаких побочных явлений, т.к. препарат изначально задумывался для применения женщинами и детьми. Это один из немногих стероидов, который не вызывает преждевременной задержки физического развития у детей, т.к. он не способствует закрытию эпифизных соединений. Поэтому в медицине препарат применяется главным образом у детей для стимуляции роста тела и у женщин при остеопорозе.

Препарат вызывает (если вообще вызывает) очень слабые явления маскулинизации. Это качество делает его хорошим средством для женщин, т.к. дозе 10-15 мг в день у них крайне редко наблюдаются внешние проявления мужеподобности.

Бодибилдеры и пауэрлифтеры любят Оксандролон. Он способствует высокому приросту силы, т.к. возбуждает синтез креатинфосфата в мышечной клетке и при этом не задерживает жидкость. Штангисты и силовики, которые не хотят переходить в более тяжелую категорию пользуются этим, т.к. препарат дает им возможность стать сильнее, не прибавляя в собственном весе.

Комбинация Оксандролона и 10-20 мг Халотестина в день показала себя очень эффективно, т.к. она дополнительно придает мускулатуре более твердый вид. Хорошие результаты дает одновременный прием Оксандролона и 120-140 мкг Кленбутерола в день. Хотя сам Оксандролон и не способствует заметному росту мышц, но заметно усиливает воздействие других стероидов на организм.

Препарат особенно хорошо комбинируется с Дека-Дураболином, Дианаболом и различными вариантами Тестостерона, которые задерживают жидкость и способствуют сильному росту мышечной ткани. Сочетание 200 мг Дека-Дураболина в неделю, 500 мг Тестостерона Энантата в неделю и 25 мг Оксандролона в день вызывает у большинства атлетов хороший прирост силы и массы. Дека-Дураболин обладает выраженным анаболическим действием и стимулирует синтез протеинов, Оксандролон повышает силу, а Тестостерон делает атлетов более агрессивными во время тренировок и ускоряет регенерацию.

Вторая причина, по которой так любят Оксандролон, заключается в том, что этот препарат не ароматизируется ни при какой дозировке. Как уже упоминалось, определенная часть находящегося в крови тестостерона превращается в эстрогены. Этот процесс ароматизации по разному выражен у разных атлетов в зависимости от предрасположенности к нему.

При Оксандролоне мускулатура никогда не приобретает водянистого вида, что позволяет считать препарат хорошим средством при подготовке к соревнованиям. В этой фазе очень важно держать уровень эстрогенов на как можно более низком уровне, т.к. эстрогены программируют организм на задержку воды даже при низкокалорийной диете. В сочетании с диетой Оксандролон помогает сделать мускулатуру твердой и упругой. Хотя сам он не разрушает жиры, но все же играет в этом косвенную роль, т.е. данное химическое вещество подавляет у многих атлетов аппетит.

Оксандролон может вызвать что-то вроде ощущения тяжести в желудке, что провоцирует у некоторых атлетов тошноту, если таблетки приняты во время еды. В инструкции по применению итальянского Оксандролона препарату приписывается влияние на деятельность желудочно-кишечного тракта. Поэтому некоторые атлеты и говорят о регулярных поносах. Хотя это и не очень приятное явление, это все же помогает атлету в его намерении сжечь жир и выглядеть более поджарым.

Те, кто готовится к соревнованиям либо заинтересован в приростах качественной мускулатуры, должны комбинировать Оксандролон с таким стероидами как Винстрол, Параболан, Мастерон, Примоболан и Тестостерона Пропионат. Сочетание 50 мг Винстрола через день, 50 мг Тестостерона Пропионата каждые два дня и 25 мг Оксандролона ежедневно показало себя очень эффективным для этой цели.

Еще одно преимущество способности Оксандролона к неароматизации в том, что атлеты, которые страдают повышенным кровяным давлением при сильных андрогенных стероидах и заполучают из-за них гинекомастию, с этим препаратом не будут иметь никаких проблем. Сочетание Оксандролона с Дека-Дураболином является для этой группы спортсменов наилучшей альтернативой, если есть проблемы со здоровьем при применении Тестостеронов, Дианабола или Анаполона 50.

Атлеты старше 40 должны использовать преимущественно Оксандролон.

Третья причина, говорящая в пользу Оксандролона, в том, что это химическое вещество даже в очень высоких дозах не оказывает влияния на выработку собственного тестостерона. Пояснение: Оксандролон не подавляет выработку гормонов в организме. Дело в том, что он не оказывает негативного влияния на дугу «гипоталамус-гипофиз-яички», т.е. при его приеме яички не сигнализируют гипоталамусу о необходимости снижения или полного прекращения выброса гормона, высвобождающего гонадотропины, и лютеинизирующий гормон, как это происходит при приеме большинства анаболических стероидов.

Это особое положение Оксандролона легко объясняется тем, что его действующее химическое вещество не ароматизируется в эстрогены. Доктор Мауро де Паскуале в своей книге «Побочные явления анаболических стероидов — факты, вымыслы и лечение» пишет на стр.23: «…предполагается, что эстрогены возникающие при ароматизации тестостерона и других анаболических стероидов, снижают секрецию лютеинизирующего гормона в отделах мозга и гипоталамусе, следовательно, и выработку тестостерона». Американский врач, доктор Роберт Керр подтверждает это в книге «Практическое применение анаболических стероидов атлетами»: «Если давать Оксандролон (Анавар) здоровому мужчине в высоких дозах, то в этом случае он не снижает ни количество семени, ни количество спермы и не превращается в эстрогены».

Поэтому Оксандролон хорошо комбинировать с Андриолом, т.к Андриол в дозе до 240 мг в день не ароматизируется и выработка организмом гормонов ни в коей мере не затрагивается. Ежедневный прием 280 мг Андриола и 25 мг Оксандролона дают хорошие результаты в приросте силы, а у новичков в стероидных курсах — и мышечной массы без чрезмерного водонакопления, а также без значительного воздействия на выработку собственного тестостерона.

Что касается непосредственно Оксандролона, то хорошие результаты приносят 8-12 таблеток в день мужчинам и 5-6 женщинам. Легкое правило ежедневного приема 0.25 мг препарата на килограмм веса оправдало себя на практике. Таблетки, как правило, принимают 2-3 раза в день сразу после еды, и тогда достигается оптимальное усвоение действующего химического вещества препарата. Те, у кого же возникает при приеме препарата желудочно-кишечные расстройства, поступают разумно, принимая таблетки через час-два после еды или вообще откажутся от него.

Т.к. Оксандролон малотоксичен и практически не вызывает побочных явлений, его принимают многие атлеты и на протяжении достаточно долгого промежутка времени. Но не стоит применять его несколько месяцев без перерыва, т.к. он, как и почти все оральные стероиды алькулирован по 17-альфа и несет в себе нагрузку на печень.

Оксандролон — средство широкого спектра воздействия, которое часто применяется культуристками. Женщины с чувствительной реакцией на анаболические стероиды достигают хороших результатов комбинируя Оксандролон и Примоболан и/или Кленбутерол, при этом не страдая явлениями маскулинизации. И все же женщины не должны принимать препарат в дозе более 6 таблеток в день, т.к. в противном случае могут возникнуть обусловленные андрогенами побочные эффекты в виде акне (угрей), снижение тембра голоса, гипертрофии клитора и усиленного выпадения волос.

Пожалуй, самый большой недостаток препарата в его высокой цене. Присутствующий на российском рынке Оксандролон итальянского производства (в упаковке 30 табл. по 2,5 мг) в среднем по Москве продается по $ 25-30. Инъекционного препарата в природе не существует, просто «умельцы» вливают в коричневую стеклянную баночку масло, а на баночку приделывают этикетку «Оксандролон инъекционный» («Oxandrolone inject»).

Цикл бодибилдинга

Oxandrolone, дозировка и побочные эффекты – CrazyBulk США

Содержание:
· Что такое Оксандролон?
· История и наука об Оксандролоне
· Оксандролон в бодибилдинге
· Анавар против Оксандролона Таблетки
· Дозировки, составы и циклы для Оксандролона
· Результаты Оксандролона
· Риски и побочные эффекты
· Какие альтернативы доступны?
· Заключение

Цикл бодибилдинга с оксандролоном, дозировка и побочные эффекты

Если бы вы делали домашнюю работу на стероидах для роста мышц, мы бы поставили деньги на то, что вы столкнулись с Оксандролоном.

Что такое Оксандролон?

Этот искусственный стероид является синтетическим аналогом тестостерона. Это означает, что он основан на тестостероне, но он был разработан для обеспечения более высокого анаболического соотношения к более низкому андрогенному. Что, черт возьми, это значит?

Анаболический термин относится к росту мышечной ткани, в то время как андрогенный используется для описания характеристик мужского развития. Подумайте о низком голосе, растительности на лице и любви к UFC. Другими словами, Оксандролон стал таким чертовски популярным, потому что, как говорят, он способствует увеличению мышечной массы с меньшим беспокойством о стрессе и нагрузке на ваши органы.

Так ли это? По правде говоря, Оксандролон может дать отличные результаты, но побочные эффекты не стоят того, чтобы бросать кости. Давайте посмотрим на историю этого стероида, как он работает, дозы Оксандролона, побочные эффекты Оксандролона и безопасную и естественную альтернативу Оксандролону.

История и наука о Оксандролоне

Oxandrolone имеет достойную и благонамеренную историю. Врачи видели, как некоторые болезни, такие как гепатит и синдром Тернера, разрушали тела людей, превращая их в кожу и кости.Они хотели найти способ лечить эти катаболические заболевания, избавляя своих пациентов от потери мышечной ткани. Так родился Оксандролон.

Первоначально оксандролон использовался для защиты мышечной массы от катаболических процессов, но исследователи в конце концов обнаружили, что это отличный способ восстановить вес после операции, травматического повреждения или стойкой инфекции.

Двумя основными механизмами действия Оксандролона являются его способность усиливать анаболические процессы или среду для роста мышц, способствуя задержке азота, особенно в мышечной ткани.Это, конечно, неплохо, что Оксандролон также может помочь восстановить или повысить аппетит.

Все это звучит великолепно, но проводились ли какие-либо исследования этого искусственного стероида? Определенно.

В одном исследовании с участием молодых мужчин исследователи хотели выяснить, способен ли Оксандролон увеличить общий синтез белка и транспортировку аминокислот, необходимых для наращивания мышечной массы, через ткани. Команда подтвердила, что краткосрочной дозы всего пять дней было достаточно, чтобы значительно увеличить синтез белка и транспортировку аминокислот, оба из которых являются важными процессами в наращивании мышечной массы.

В другом исследовании с участием пожилых мужчин аналогичные результаты были получены у субъектов, демонстрирующих повышенный уровень синтеза белка, сухой мышечной ткани и потерю жира. Загвоздка в том, что большая часть их мышечной массы была потеряна через 12 недель после прекращения приема Оксандролона, но им удалось остаться стройными и относительно обезжиренными.

Хотя он никогда не разрабатывался с целью стимулировать работу мозга, недавние исследования показывают, что Оксандролон может помочь вам напрячь умственные мышцы.В одном исследовании исследователи обнаружили, что Оксандролон способен восстанавливать и повышать уровень миелина, защитного слоя мозга на его электрической супермагистрали клеточных мессенджеров. Другими словами, отличные новости для клеток мозга.

Оксандролон в бодибилдинге


Давайте посмотрим: было обнаружено, что Оксандролон защищает мышечную массу от некоторых дьявольских болезней, способствует росту мышц и имеет высокий уровень успеха. Стоит ли удивляться, что он оказался в мире бодибилдинга?

Вскоре после того, как Оксандролон появился на медицинском рынке, он начал появляться в спортзалах по всей территории Соединенных Штатов в 1980-х годах.Учитывая его низкие андрогенные свойства и высокие анаболические свойства, он был популярным выбором для тех, кто смотрел на сцену.

Несмотря на то, что около сорока лет назад Оксандролон стал популярным средством для наращивания мышечной массы, он по-прежнему остается одним из самых популярных нелегальных стероидов. С чудесами простого интернет-поиска стало проще, чем когда-либо, найти оксандролон в продаже, чтобы поддержать ваши мечты о бодибилдинге, но есть огромная загвоздка: большинство форм онлайн-оксандролона не являются медицинским классом и несут потенциал для плохой реакции.

Анавар против таблеток Оксандролон

Говоря о поиске нелегальных стероидов в Интернете, одна из самых популярных фраз, вводимых в Google, — «Анавар против Оксандролона». Ирония здесь в том, что Анавар — это просто торговая марка Оксандролона.

Скажем так: Оксандролон — это научное или труднопроизносимое название. Если вы хотите продавать лекарства, даже стероиды, вам нужно что-то более сексуальное. Представляем Анавар. Видите, насколько проще это сказать?

Но есть ли между ними разница? Может быть, небольшой, в зависимости от того, получаете ли вы дженерик Оксандролон или торговую марку Анавар.Оксандролон идентичен Анавару на уровне формулы, но вы заметите разницу во внешнем виде таблеток и дозировке каждой из них.

Дозировки, стеки и циклы для Оксандролона


Говоря о дозировках, какова правильная дозировка Оксандролона? Вот обычно используемые дозировки, стеки и циклы для Оксандролона, но мы не рекомендуем их. Почему? Эти вещества и стеки представляют огромный риск для здоровья, не говоря уже о тюремном заключении.

Оксандролон Дозировка:

В зависимости от опыта пользователя, массы тела и целей уровни дозировки будут варьироваться:

· Мужчины: от 30 до 80 мг в день
· Женщины: от 5 до 15 мг в день

Мы видели дозы до 100 мг в день для мужчин и 20 мг в день для женщин, но это не очень распространено.Чем выше доза, тем больше вероятность того, что вы столкнетесь с побочными эффектами и проблемами со здоровьем.

Оксандролон

имеет период полураспада от 8 до 10 часов, поэтому суточную дозу следует разделить на две порции. Например, если вы принимаете 30 мг в день, вы будете принимать 15 мг утром и 15 мг вечером.

Цикл Оксандролон

Типичный курс Оксандролона длится шесть недель, после чего следует послекурсовая терапия, добавка, которая используется для устранения повреждения печени и запуска подавленного тестостерона.Имейте в виду, что даже самые лучшие добавки для послекурсовой терапии (ПКТ) не всегда помогают устранить ущерб.

Оксандролон Стеки

Существует два широко применяемых комплекса Оксандролона: Тестостерон Энантат и Винстрол:

Оксандролон и тестостерон энантат:

Неделя 1:
· Оксандролон: 30 мг
· Тестостерон энантат: 300 мг

Неделя 2:
· Оксандролон: 30 мг
· Тестостерон энантат: 300 мг

Неделя 3:
· Оксандролон: 30 мг
· Тестостерон энантат: 300 мг

Неделя 4:
· Оксандролон: 30 мг
· Тестостерон энантат: 300 мг

Неделя 5:
· Оксандролон: 30 мг
· Тестостерон энантат: 300 мг

Неделя 6:
· Оксандролон: 30 мг
· Тестостерон Энантат: 300 мг

Оксандролон и Винстрол:

Неделя 1:
· Оксандролон: 30 мг
· Винстрол: 50 мг

Неделя 2:
· Оксандролон: 30 мг
· Винстрол: 50 мг

Неделя 3:
· Оксандролон:
· Винстрол: 50 мг

Неделя 4:
· Оксандролон: 30 мг
· Винстрол: 50 мг

Неделя 5:
· Оксандролон: 30 мг
· Винстрол: 50 мг

Неделя 6:
· Оксандролон: 30 мг
· Винстрол: 50 мг

Оксандролон Результаты

Настоящий Оксандролон – препарат медицинского назначения – стоит недешево.Это требует времени и усилий, чтобы получить в свои руки. И это может нанести адский удар по вашей печени и другим органам. Итак… оно того стоит? Есть три основных области, которые пользователи Oxandrolone называют точками, в которых они видят наиболее впечатляющие результаты:

.

Рост мышц: Это данность. Оксандролон был создан специально для того, чтобы защитить мышцы от разрушения, одновременно побуждая организм набирать их больше. Причина номер один, по которой люди принимают Оксандролон (Анавар), заключается в том, чтобы увидеть большие мышцы.

Dry Gains: Oxandrolone также популярен в период сушки, потому что говорят, что при более низких дозировках он увеличивает размер без громоздкого или раздутого вида.

Потеря жира: Продолжая предыдущий пункт, еще одна причина, по которой Оксандролон принимают во время сезона сушки, заключается в его способности способствовать потере жира. Как мы обсуждали в исследовании выше, пожилые мужчины потеряли вес и сохранили его после использования Оксандролона.

Риски и побочные эффекты

Как и все анаболические стероиды, есть цена, которую ваше тело будет платить, когда вы принимаете Оксандролон; тем более если злоупотреблять.Наиболее распространенные побочные эффекты Оксандролона могут включать следующее:

· Акне
· Потеря либидо
· Гинекологические или мужские сиськи
· Агрессия или чрезмерное возбуждение
· Бессонница
· Подавление тестостерона
· Изменяет уровень холестерина, увеличивая риск сердечно-сосудистых заболеваний, таких как сердечный приступ

Узнайте больше о побочных эффектах Анавара, которых следует избегать.

Какие альтернативы доступны?

Один из лучших способов насладиться преимуществами Анавара (оксандролона) без риска перенапряжения печени или неприятных побочных эффектов — это Анварол.

Анварол — это полностью легальная и натуральная альтернатива оксандролону (анавару), которая была разработана, чтобы помочь вам максимизировать прирост мышечной массы, что делает его обязательным как в сезон набора массы, так и в сезон измельчения.

Подходит как мужчинам, так и женщинам, Anvarol помогает вам на трех уровнях:

Повышение силы: Анварол содержит динатрий аденозин-5′-трифосфата, который является предпочтительным источником топлива для мышечной ткани во время тренировок по бодибилдингу.

Наращивание мышечной массы: Анварол содержит соевый протеин, сывороточный протеин и аминокислоты с разветвленной цепью в соотношении 2:1:1, буквально строительные блоки мышечной ткани.

Сжигание жира: Экстракт ямса был в центре внимания за то, что он помогает поддерживать здоровый вес, правильное пищеварение и укрепляет сердечно-сосудистую систему.

Заключение

Если вашей целью является наращивание мышечной массы, может возникнуть соблазн попробовать Оксандролон, так как он буквально создан для мышц. Однако не романтизируйте этот нелегальный стероид; это лекарство для больных.

Реальность такова, что вы вряд ли найдете Оксандролон медицинского назначения на улице.Если вы это сделаете, вы потратите с трудом заработанные деньги на ряд потенциальных побочных эффектов, включая повреждение печени. И все это ради нескольких лишних килограммов мышц.

Получите лучшее из всего; сэкономьте деньги, нарастите массу и пощадите печень с помощью Anvarol.

Измельчите с CrazyBulk

Сожгите этот жир и серьезно похудейте с добавками для похудения CrazyBulk. Хотите преобразить свое тело? Тогда попробуйте эти 100% легальные альтернативы стероидам и поднимите свои тренировки на новый уровень!

Обзор Anavar

и его альтернатива — вот почему вам следует избегать его употребления!

С подросткового возраста я хотел участвовать и соревноваться в соревнованиях по бодибилдингу.Сейчас мне немного за тридцать, я преподаю в городском колледже.

Из-за плотного графика я стараюсь выкроить пару часов вечером, чтобы позаниматься в спортзале. Это помогает мне поддерживать свое телосложение и поддерживает мое общее здоровье на должном уровне.

Все шло довольно гладко, но ситуация резко изменилась, когда мой колледж решил организовать программу мероприятий, которая должна была состояться в конце учебного года в колледже.

Поскольку я старший учитель в школе, на меня возложили некоторые из самых важных обязанностей.В итоге за время подготовки я три месяца не могла найти время на посещение спортзала.

За эти три месяца я начал потреблять все, до чего мог дотянуться. Лично я думаю, что стресс от идеального выполнения программы деятельности в конце года достал меня.

Именно тогда я смог заметить, что начал терять свое телосложение, и я чувствовал, что мой вес увеличивается из-за большого количества нежелательного жира.

Это делало меня еще более напряженным, и, как следствие, уровень моего разочарования достигал своего предела всякий раз, когда что-то шло не так.

Вскоре наступил день «д», на этом подготовка к программе была почти завершена. Увидев это, я вздохнул с облегчением и сказал себе, что теперь смогу сосредоточиться на своем теле и регулярно ходить в спортзал.

В рамках годовой программы был спонсор, распространявший справочник некоторых соревнований по бодибилдингу, которые должны были состояться в соседнем городе.

Позже я узнал, что справочник распространялся Национальным комитетом по телосложению. Увидев все это, мои глаза заблестели, я был очень счастлив и просто хотел зарегистрироваться на конкурс.

Чтобы не пропустить, долгие каникулы от расписания колледжа после программы были для меня как вишенка на торте. На следующий день я начал искать дополнительную информацию о соревнованиях по бодибилдингу, упомянутых в справочнике.

Наконец-то я нашел всю подробную информацию о том же самом. Я видел, что предстоящие соревнования по бодибилдингу должны были состояться в декабре следующего года.

Я подумал, что у меня достаточно времени, чтобы поддерживать свое телосложение, как раньше.В конечном итоге это помогло бы конкурировать. Теперь я действительно был полон решимости участвовать в конкурсе.

Рано утром я помчался в спортзал. Мой тренер был удивлен энтузиазмом, с которым я пришел в спортзал. Вслед за этим я сообщил ему о своем участии в предстоящем соревновании по бодибилдингу.

После этого он тоже был готов работать над моим телом. Так как он был знаком с моими тренировками. После двух дней регулярных тренировок он предложил мне рассмотреть Анавар для поддержки здоровья.

По его словам, это поможет мне улучшить общий процесс поддержания желаемого телосложения. Для начала он подключил меня к диетологу.

На следующий день я встретила того диетолога. Она спланировала мою диету и помогла мне правильно потреблять белок.

Она также рассказала мне о белках. Она упомянула, что белки содержат аминокислоты, которые могут помочь мне в поддержании мышечной ткани и укрепить строительные блоки для общего роста мышц.

Мой тренер сопровождал меня в магазин товаров для здоровья, где я купил флаконы Anavar для регулярного использования.

Какую дозу Анавара (оксандролона) мне следует использовать?

Список содержимого

[Закрыть]

[Открыть]

В сегодняшней статье, как вы можете догадаться из названия, мы рассмотрим, как дозировать Оксандролон, он же Анавар. Учитывая, что правильная дозировка анаболических стероидов имеет решающее значение для распространения как положительных, так и отрицательных эффектов, крайне важно уделить немного времени, чтобы выяснить, какие дозировки могут работать лучше всего для вас.К счастью, мы знаем кое-что об анаболических стероидах, поэтому мы написали эту статью о том, как дозировать Анавар, поскольку мы хотим предоставить вам, нашим уважаемым читателям, единую статью, в которой рассказывается все, что вам нужно знать об этом. Анавар дозы. Итак, без лишних слов, приступим.

Сколько Anavar я должен использовать? Эти 4 фактора определят вашу правильную дозировку Анавара!

Как и в случае со всеми анаболическими стероидами, дозировка является субъективной, и Анавар, безусловно, ничем не отличается.Вопрос в том, сколько Оксандролона вы должны использовать? 10мг? 20мг? 50 мг?

Чтобы понять, сколько Анавара вам следует принимать, необходимо принять во внимание четыре фактора (в произвольном порядке):

  1. Опыт с анаболическими стероидами.
  2. Размер/вес/уровень мускулатуры.
  3. Цели цикла.
  4. Какие другие ААС принимаются вместе с Анаваром?

Давайте обсудим каждый по очереди.

Стероидный опыт

При прочих равных условиях, чем больше циклов стероидов вы проводите (и чем большее количество мышечной массы вы наращиваете и поддерживаете), тем более высокие дозы требуются в вашем следующем цикле для достижения аналогичного прироста. Конечно, это нелинейно, и на это может повлиять множество факторов, но, как правило, по мере увеличения вашего опыта приема стероидов потребность в более высоких дозировках также увеличивается. Таким образом, если вы принимали стероиды раньше, ваша доза Анавара должна быть выше, чем у человека с нулевым опытом приема стероидов.

Вес/размер

Это связано с приведенным выше пунктом об опыте приема стероидов, так как чем больше циклов у вас за плечами, тем крупнее вы будете, а это означает, что вам потребуются более высокие дозы каждый раз, когда вы проходите цикл. Это также то, что новички в стероидах тоже должны принимать во внимание. Например, двум новичкам с разницей в весе в 30 фунтов (например, 170 фунтов против 200 фунтов), которые хотят пробежать один и тот же цикл с одинаковыми целями, вероятно, потребуются немного разные дозы, т.е.е., более тяжелому человеку обычно требуется немного больше.

Цели цикла

Существует четыре типичных «цели» стероидного цикла: набор массы, сушка, (чистая) сила и восстановление. Хотя Анавар обычно используется для последних трех, его можно использовать с более распространенными стероидами для набора массы, такими как тестостерон и Дека Дураболин, для наращивания мышечной массы. Цель вашего цикла может иметь некоторое влияние на вашу дозировку.

Принимаемые другие стероиды

Стероид, принимаемый отдельно, должен потребляться в гораздо более высоких дозах, чем если он сочетается с другими анаболическими стероидами; поэтому, если вы комбинируете Анавар с другими стероидами, вам нужно будет использовать его в более низких дозах.

Теперь, когда мы рассмотрели различные факторы, влияющие на дозировку Оксандролона, было бы разумно «подключить» эти знания и использовать их для нескольких реальных примеров. В конце концов, приведенная выше информация, хотя и необходимая, на самом деле не говорит вам, сколько Анавара нужно принимать.

Прежде чем мы обсудим примеры, обязательно заявим, что нижеследующее не является медицинским советом, а просто основано на наших знаниях и опыте. Дозировка стероидов должна подбираться индивидуально для каждого человека, поэтому дальнейшую информацию следует использовать только в качестве рекомендации.

Дозировка Анавара: примеры из практики

Несмотря на то, что невозможно охватить каждый отдельный сценарий (если бы мы попытались, мы были бы здесь весь день!), мы можем привести достаточно примеров, чтобы дать вам представление о том, как вам следует продолжать курс Анавара, независимо от вашего текущего опыта, массы тела. , велоцели и т.д.

Доза оксандролона для начинающих

Вот наши рекомендуемые протоколы дозирования для новичков:

  • Отдельный курс Анавара: 30–50 мг (в общей сложности от шести до восьми недель).
  • В сочетании с инъекционными стероидами: 20-30 мг (в течение первых четырех-шести или последних четырех-шести недель цикла).
  • В сочетании с пероральными стероидами: 20–30 мг.

Новичкам с более низкой массой тела/уровнями мускулатуры следует уменьшить верхние дозы примерно на 10 мг.

Примерный график приема Анавара для начинающих может выглядеть следующим образом.

Неделя 1

Анавар отдельно: 30 мг в день

В сочетании с инъекционными препаратами: 20 мг в день

При приеме внутрь: 20 мг в день

Неделя 2

Анавар отдельно: 30 мг в день

В сочетании с инъекционными препаратами: 20 мг в день

При приеме внутрь: 20 мг в день

Неделя 3

Анавар отдельно: 30 мг в день

В сочетании с инъекционными препаратами: 20 мг в день

При приеме внутрь: 20 мг в день

Неделя 4

Анавар отдельно: 40 мг в день

В сочетании с инъекционными препаратами: 20 мг в день

При приеме внутрь: 20 мг в день

Неделя 5

Анавар отдельно: 40 мг в день

В комплекте с инъекционными препаратами:

При приеме внутрь: 30 мг в день

Неделя 6

Анавар отдельно: 40 мг в день

В комплекте с инъекционными препаратами:

При приеме внутрь: 30 мг в день

Неделя 7

Анавар отдельно: 50 мг в день

В комплекте с инъекционными препаратами:

В наборе с оральными отверстиями:

Неделя 8

Анавар отдельно: 50 мг в день

В комплекте с инъекционными препаратами:

В наборе с оральными отверстиями:

НЕДЕЛЯ АВТОНОМНЫЙ С ИНЪЕКЦИОННЫМИ СРЕДСТВАМИ С ОРАЛАМИ
1 30 мг в день 20 мг в день 20 мг в день
2 30 мг в день 20 мг в день 20 мг в день
3 30 мг в день 20 мг в день 20 мг в день
4 40 мг в день 20 мг в день 20 мг в день
5 40 мг в день 30 мг в день
6 40 мг в день 30 мг в день
7 50 мг в день
8 50 мг в день

Фигуры и дозы указанные на этой странице только для справки.Каждое тело отличается, и вы должны научиться знать свое тело. советую начинать медленно и не переусердствовать. Проявите должную осмотрительность, прислушайтесь к своему телу и не слепо следуйте любому из предложенных на этой странице продуктов или доз. Этот сайт не будет проводиться ответственность за любой ущерб, нанесенный вашему телу.

Доза оксандролона для опытных пользователей

Вот наши рекомендуемые протоколы дозирования для опытных или продвинутых пользователей для достижения наилучших результатов с Анаваром:

  • Отдельный курс Анавара: 40–100 мг (в общей сложности от шести до восьми недель).
  • В сочетании с инъекционными стероидами: 20-80 мг (в течение первых четырех-шести или последних четырех-шести недель цикла).
  • В сочетании с пероральными стероидами: 20–60 мг.

Опытные пользователи с более низкой массой тела/уровнями мускулатуры должны уменьшить верхние дозы примерно на 10 мг.

Примерный график приема Анавара для опытных бодибилдеров может выглядеть следующим образом.

Неделя 1

Анавар отдельно: 40 мг в день

В сочетании с инъекционными препаратами: 20 мг в день

При приеме внутрь: 20 мг в день

Неделя 2

Анавар отдельно: 40 мг в день

В сочетании с инъекционными препаратами: 20 мг в день

При приеме внутрь: 20 мг в день

Неделя 3

Анавар отдельно: 50 мг в день

В сочетании с инъекционными препаратами: 30 мг в день

При приеме внутрь: 30 мг в день

Неделя 4

Анавар отдельно: 60 мг в день

В сочетании с инъекционными препаратами: 40 мг в день

При приеме внутрь: 30 мг в день

Неделя 5

Анавар отдельно: 60 мг в день

В комплекте с инъекционными препаратами:

При приеме внутрь: 40 мг в день

Неделя 6

Анавар отдельно: 70 мг в день

В комплекте с инъекционными препаратами:

При приеме внутрь: 40 мг в день

Неделя 7

Анавар отдельно: 70 мг в день

В комплекте с инъекционными препаратами:

В наборе с оральными отверстиями:

Неделя 8

Анавар отдельно: 80 мг в день

В комплекте с инъекционными препаратами:

В наборе с оральными отверстиями:

НЕДЕЛЯ АВТОНОМНЫЙ С ИНЪЕКЦИОННЫМИ СРЕДСТВАМИ С ОРАЛАМИ
1 40 мг в день 20 мг в день 20 мг в день
2 40 мг в день 20 мг в день 20 мг в день
3 50 мг в день 30 мг в день 30 мг в день
4 60 мг в день 40 мг в день 30 мг в день
5 60 мг в день 40 мг в день
6 70 мг в день 40 мг в день
7 70 мг в день
8 80 мг в день

Вам, как опытному пользователю, также могут быть интересны другие наши публикации на как правильно подобрать дозы при циклическом приеме Анавара с винстролом и кленбутеролом.

Не забудьте также прочитать мой личный опыт с циклом только Anavar. Я пробовал один два раза, и в упомянутом посте я рад поделиться тем, как они сработали для меня.

Фигуры и дозы указанные на этой странице только для справки. Каждое тело отличается, и вы должны научиться знать свое тело. советую начинать медленно и не переусердствовать.Проявите должную осмотрительность, прислушайтесь к своему телу и не слепо следуйте любому из предложенных на этой странице продуктов или доз. Этот сайт не будет проводиться ответственность за любой ущерб, нанесенный вашему телу.

Дозировка Анавара: Заключительные мысли

В конечном счете, дозировка стероидов не является точной наукой, и не существует каких-либо жестких и быстрых правил, которым следует следовать буквально.Однако следует руководствоваться здравым смыслом. К сожалению, многие пользователи, особенно новички в анаболических стероидах и допингах, считают, что чем больше, тем лучше; это не так. Учитывая, что стероиды могут иметь неблагоприятные последствия для здоровья, всегда разумно придерживаться мантры «меньше значит больше»; лучше перестраховаться, чем забыть о своем здоровье!

Анаболические стероиды намного мощнее, чем думает большинство людей, и им не требуются огромные дозы для наращивания значительного количества мышц и силы.Даже 40 мг Анавара, который предположительно является «слабым» стероидом, помогут нарастить несколько фунтов мышц и резко увеличить силу в течение шести-восьми недель, при условии, что диета и тренировки подобраны и оптимизированы.

Также важно следить за своим телом на протяжении всего цикла и отслеживать показатели здоровья, даже если вы чувствуете себя хорошо. Анавар, как и все андрогены, известен тем, что оказывает негативное влияние на уровень холестерина, триглицеридов, показатели печени (хотя и не в такой степени, как более сильные пероральные препараты, такие как Анадрол и Супердрол) и артериальное давление, поэтому, безусловно, рекомендуется внимательно следить за этим. на этих.Кроме того, если вы сделаете это и увидите, что ваше тело хорошо справляется с определенной дозой, это даст вам возможность увеличить дозу.

Краткосрочное введение Оксандролона стимулирует синтез чистого мышечного белка у молодых мужчин1 | Журнал клинической эндокринологии и метаболизма

Краткосрочное введение тестостерона стимулирует чистый синтез белка у здоровых мужчин. Мы исследовали, улучшит ли оксандролон [Оксандрин (OX)], синтетический аналог тестостерона, чистый синтез мышечного белка и транспорт аминокислот через ногу.Шесть здоровых мужчин [22 ± 1 (±se) года] были исследованы в постабсорбтивном состоянии до и после 5 дней перорального приема OX (15 мг/день). Синтез и расщепление мышечного белка определяли с помощью трехкомпонентной модели с использованием данных о стабильных изотопах, полученных при заборе бедренных артериовенозных проб и биопсии мышц. Метод прекурсора-продукта использовали для определения фракционной скорости синтеза мышечного белка. Также были непосредственно рассчитаны фракционные скорости разрушения. Концентрации общей информационной рибонуклеиновой кислоты (мРНК) инсулиноподобного фактора роста I скелетных мышц и рецептора андрогена (AR) определяли с помощью RT-PCR.Полученный с помощью модели синтез мышечного белка увеличился с 53,5 ± 3 до 68,3 ± 5 (среднее значение ± se) нмоль/мин·100 мл/нога ( P <0,05), в то время как расщепление белка не изменилось. Внутренний транспорт аминокислот оставался неизменным при приеме OX, тогда как внешний транспорт снижался ( P <0,05). Скорость фракционного синтеза увеличилась на 44% ( P < 0,05) после введения ОХ без изменения скорости фракционного распада. Таким образом, чистый баланс между синтезом и распадом стал более положительным при использовании обеих методологий ( P < 0.05) и не отличался от нуля. Кроме того, RT-PCR показала, что введение OX значительно увеличивало концентрацию мРНК AR скелетных мышц без изменения концентрации мРНК инсулиноподобного фактора роста I. Мы пришли к выводу, что кратковременное введение ОХ стимулировало увеличение синтеза белков скелетных мышц и улучшало внутриклеточную реутилизацию аминокислот. Механизм этой стимуляции может быть связан с OX-индуцированным увеличением экспрессии AR в скелетных мышцах.

СПОРТСМЕНЫ уже давно используют анаболические средства для увеличения сухой мышечной массы и силы.Тем не менее, клиницисты только недавно признали преимущества анаболических агентов для пациентов с истощением мышц, связанным с травмами и заболеваниями. Недавно несколько клинических исследований продемонстрировали положительный эффект введения тестостерона (Т) различным группам пациентов. В частности, заместительная терапия тестостероном приносит пользу мужчинам с гипогонадизмом за счет увеличения массы скелетных мышц (1–3), увеличения плотности костной ткани (2) и увеличения синтеза белка (1). Аналогичным образом, у пожилых мужчин, получающих заместительную терапию тестостероном, увеличивается мышечная масса тела (4), сила (5) и синтез белка (5) наряду со снижением резорбции кости (4).Кроме того, изменения в составе тела, в том числе потеря безжировой массы тела, сильно коррелируют с уровнями андрогенов у мужчин с гипогонадизмом и синдромом приобретенного иммунодефицита (СПИД) с истощающей миопатией (6).

Недавно мы показали, что энантат энантата (ТЭ), вводимый внутримышечно здоровым молодым мужчинам, увеличивает общий синтез белка и повторное использование внутриклеточных аминокислот в скелетных мышцах (7). Кроме того, несколько других исследований показали, что введение тестостерона увеличивает синтез мышечного белка (1, 5, 8), хотя в этих исследованиях не удалось измерить расщепление белка.Одним из основных ограничений предыдущих исследований фракционной скорости синтеза (FSR) является невозможность одновременной оценки расщепления белка. Следовательно, традиционный подход к изучению кинетики мышечного белка (, т.е. FSR) не давал информации о чистом балансе между синтезом и распадом. Поэтому наша лаборатория разработала новый метод измерения фракционного распада белка, который не зависит от артериовенозной (AV) модели (9).

Хотя природные андрогены, такие как Т, явно стимулируют синтез мышечного белка, они также обладают андрогенным или вирилизирующим действием.Часто это ограничивает использование клиницистами этих андрогенов определенными группами пациентов, такими как мужчины с гипогонадизмом. Тем не менее, были предприняты усилия по поиску альтернативных анаболических агентов, которые можно было бы использовать у женщин и детей, страдающих заболеваниями или травмами, приводящими к истощению мышц. Оксандролон [Oxandrin (OX) Bio-Technology General, Iselin, NJ], синтетический аналог T, является пероральным анаболическим стероидом, который в настоящее время используется в качестве дополнительной терапии для увеличения веса у пациентов после операций, хронических инфекций и тяжелых травм.ОХ улучшал прибавку в весе у пациентов с миопатией, сопровождающейся истощением при СПИДе (10), а также у выздоравливающих пациентов с ожогами (ожоги на 30–50% от общей площади поверхности тела) (11). Кроме того, OX используется клиницистами для лечения детей с нарушениями роста, такими как синдром Тернера и конституциональная задержка роста и полового созревания (12, 13). Недавнее экспериментальное исследование с участием мальчиков с мышечной дистрофией Дюшенна показало, что ОХ, назначаемый в дозе 0,1 мг/кг в день, увеличивает мышечную силу в течение 3-месячного периода (14). Учитывая, что OX вводят перорально, в отличие от внутримышечного введения, как при TE, простота его введения делает его привлекательным как для клиницистов, так и для пациентов.Кроме того, предполагается, что ОХ обладает гораздо большим анаболическим потенциалом, чем Т, с меньшим андрогенным эффектом. Однако ни одно исследование не показало, способствует ли ОХ, как и ТЭ, стимуляции синтеза белка в скелетных мышцах.

Таким образом, мы исследовали, улучшает ли ОХ, предполагаемый анаболический агент, чистый синтез мышечного белка и транспорт аминокислот у голодающих молодых мужчин. Настоящее исследование было разработано, чтобы имитировать 5-дневное исследование ТЭ у нормальных мужчин, которое обсуждалось ранее (7).Мы стремились оценить краткосрочное (5-дневное) влияние умеренной дозы (15 мг/день) ОХ на включение аминокислот в мышечные белки, используя устоявшуюся белковую кинетическую модель (15, 16). Далее мы изучили влияние OX на концентрацию информационной рибонуклеиновой кислоты (мРНК) скелетно-мышечного инсулиноподобного фактора роста I (IGF-I) и рецепторов андрогенов (AR).

Предметы и методы

Субъектов

Шесть здоровых мужчин [возраст 22 ± 3 (± стандартное отклонение) года; вес 77 ± 13 кг; рост 178 ± 7 см] изучали до и после приема суточной дозы перорального ОХ (15 мг/сут) в течение 5 дней.Все субъекты дали информированное письменное согласие в соответствии с рекомендациями, установленными экспертным советом медицинского отделения Техасского университета (Галвестон, Техас). Пригодность субъекта оценивалась путем проведения медицинского скрининга, который включал электрокардиограмму, анализ крови, электролиты плазмы, концентрацию глюкозы в крови, а также тесты функции печени и почек. Субъекты с заболеваниями сердца или печени, нарушениями гипо- или гиперкоагуляции, сосудистыми заболеваниями, гипертонией, диабетом или аллергией на йодиды были исключены из участия.

Экспериментальный протокол

Все исследования инфузии изотопов проводились в Центре общих клинических исследований Медицинского отделения Техасского университета. Субъектов госпитализировали за ночь перед каждым исследованием и не кормили с 22:00 до завершения 5-часового исследования с инфузией изотопов. Примерно в 06:30 утра следующего дня (день 0) полиэтиленовый катетер 20-го калибра (Insyte-W, Becton Dickinson and Co., Sandy, UT) был вставлен в локтевую вену одной руки для инфузии аминокислот.Второй полиэтиленовый катетер 20-го калибра был помещен в контралатеральное запястье для забора крови для измерения системного индоцианина зеленого (ICG). На руку и запястье накладывали грелку для поддержания температуры около 65°С во время измерения кровотока.

В 07:00 в дни 0 и 5 были взяты базовые образцы крови для анализа фонового обогащения аминокислотами, концентрации ICG и пиковых концентраций T и OX. Первичную непрерывную инфузию меченого фенилаланина начинали при следующей скорости инфузии (IR) и начальной дозе (PD): 1-[кольцо- 2 H 5 ]фенилаланин, IR = 0.05 мкмоль/кг·мин, PD = 2 мкмоль/кг. Примерно в 07:30 в бедренную артерию и вену под местной анестезией был помещен 8-сантиметровый полиэтиленовый катетер Кука 3-Fr (Блумингтон, Индиана). Бедренные катетеры требовались для забора крови из аорты и инфузии ICG (артерия) для определения кровотока в ноге.

Биопсия латеральной широкой мышцы бедра была получена через 2 часа, 4 часа 30 минут и 5 часов инфузии индикатора с использованием 5-мм иглы Бергстрема, как описано ранее (16). Ткань немедленно замораживали в жидком азоте и хранили при температуре -80°С до проведения анализа.После 2-часовой биопсии была начата непрерывная инфузия 1-[ 15 N]фенилаланина (2 мкмоль/кг), которая поддерживалась до 4 часов (рис. 1). Артериальное и внутриклеточное обогащение 1-[ 15 N]фенилаланином на плато и снова после распада было получено для целей определения фракционной скорости распада (FBR). Биопсия через 4 часа 30 минут и 5 часов использовалась для определения FBR. Фракционную скорость синтеза (FSR) белка скелетных мышц определяли по включению в белок l-[ring- 2 H 5 ]фенилаланина в течение 2–5 часов.

Рис. 1.

Протокол инфузии стабильных изотопов. кольцо- 2 H 5 -PHE, 1-[кольцо- 2 H 5 ]фенилаланин; 15 N-PHE, 1-[ 15 N]фенилаланин.

Рис. 1.

Протокол инфузии стабильных изотопов. кольцо- 2 H 5 -PHE, 1-[кольцо- 2 H 5 ]фенилаланин; 15 N-PHE, 1-[ 15 N]фенилаланин.

Образцы а-в крови получали с 20-минутными интервалами от 4 до 5 часов для определения кинетики аминокислот.За пятнадцать минут до часа отбора проб была начата непрерывная инфузия (IR = 0,5 мг/мин) ICG, которая позволяла достичь системного равновесия (10–15 минут) для измерения кровотока в ногах. Последующий забор крови производился одновременно из бедренной вены и нагретой вены запястья в течение часа забора крови. Чтобы не нарушить измерения кровотока, все образцы АВ крови для кинетики аминокислот были получены после проведения измерений кровотока, и ICG была остановлена. ICG перезапускали и позволяли работать непрерывно в течение примерно 10–15 минут перед следующим измерением кровотока.

В конце 5-часового исследования с инфузией испытуемых накормили и удалили все периферические и бедренные катетеры. Начиная с 21:00 дня 0, всем субъектам давали 15 мг OX (BTG Pharmaceuticals Co., Iselin, NJ) перорально в течение 5 дней. На 3-й день испытуемые вернулись в Общий клинический исследовательский центр в 07:00 для забора венозной крови для определения общих концентраций Т и ОХ. На 5-й день повторили описанный выше экспериментальный протокол.

Аналитические методы

Кровь. Концентрации немеченого и меченого фенилаланина определяли методом газовой хроматографии-масс-спектрометрии (ГХ-МС), как описано ранее (16). Вкратце, образцы крови AV собирали в предварительно взвешенные пробирки, содержащие 15% сульфосалициловой кислоты. Добавляли известный внутренний стандарт (100 мкл/мл крови) и тщательно перемешивали. Состав этой стандартной смеси составлял 50,3 мкмоль/л 1-[кольцо- 13 С 6 ]фенилаланина. После повторного взвешивания пробирок для определения конечного объема крови пробирки центрифугировали, супернатант собирали и хранили при -20°С до анализа.Аминокислоты крови разделяли с помощью катионообменной хроматографии (16) и обогащения внутреннего стандарта, а введенные индикаторы определяли на их производных трет--бутилдиметилсилила ( t -BDMS) (17). С помощью ГХ-МС определяли изотопное обогащение свободных аминокислот в крови с помощью положительной химической ионизации и мониторинга отдельных ионов (модель 5973, Hewlett-Packard Co., Пало-Альто, Калифорния). Наконец, кровоток в ногах определяли спектрофотометрически путем измерения концентрации ICG в сыворотке при λ = 805 нм.

Мышца. Взвешивали образцов мышц и белок осаждали 500 мкл 14% хлорной кислоты. Известный раствор внутреннего стандарта (2 мкл/мг мышечной ткани) добавляли для измерения внутриклеточных концентраций фенилаланина. Раствор содержал 2,4 мкмоль/л 1-[кольцо- 13 С 6 ]фенилаланина. Супернатант собирали после гомогенизации ткани и центрифугирования. Эту процедуру повторяли трижды. Объединенный супернатант с мышечными аминокислотами разделяли с помощью катионообменной хроматографии (16).Обогащение и концентрации внутриклеточных аминокислот определяли на их трет--бутилметилсилильных производных (17) с использованием ГХ-МС в режиме электронного удара. Внутриклеточное обогащение определяли с поправкой на внеклеточную жидкость на основе хлоридного метода (18). Оставшийся осадок несколько раз промывали 0,9%-ным солевым раствором и снова абсолютным этанолом, сушили при 50°С в течение ночи и гидролизовали в 6 н HCl при 110°С в течение 24 часов. Затем гидролизат пропускали через катионообменную колонку таким же образом, как и кровь.Образцы анализировали на обогащение фенилаланином с помощью ГХ-МС (модель 8000, MD 800, Fisons Instruments, Манчестер, Великобритания) с использованием химической ионизации и метода стандартной кривой (19).

Анализы на гормоны. Концентрацию общего Т в сыворотке измеряли с помощью коммерческого набора RIA (Diagnostic Products, Los Angeles, CA). Свободный или биодоступный тестостерон измеряли с помощью равновесного диализа [Mayo Medical Laboratories (Рочестер, Миннесота), Quest Diagnostics, Inc., Институт Николса (Сан-Хуан-Капистрано, Калифорния)].Концентрации OX в сыворотке измерялись Олимпийской аналитической лабораторией Калифорнийского университета в Лос-Анджелесе. Вкратце, жидкостно-жидкостную экстракцию проводили путем добавления 50 мкл внутреннего стандарта [16,16,17- 3 H]T (d 3 T; 12 мкг/мл; MSD Isotopes, Montreal, Que.), 1 мл 50% насыщенного буфера ацетата натрия (0,5 моль/л; pH 5,5) и этилового эфира (5 мл) до 0,5 мл плазмы. После встряхивания (10 мин) и центрифугирования (15 мин при 2000 об/мин) слой этилового эфира сушили в атмосфере азота при комнатной температуре и восстанавливали в 200 мкл метанола для высокоэффективного жидкостного хроматографического анализа.Жидкостную хроматографию выполняли на системе Shimadzu (Shimadzu, Columbia, MD), оснащенной колонкой Hypersil BDS C 18 , 50 × 2 мм (Keystone Scientific, Inc., Bellefonte, PA) и Hypersil BDS C 18 , Предколонка 20 × 2 мм, работающая при скорости потока 400 мкл/мин. Объем инъекции составлял 5 мкл. Градиент: метанол-вода (1:1) в течение 1 мин, метанол-вода (9:1) в течение следующей 1 мин, выдержка 1 мин и возврат в исходное состояние через 0,5 мин. МС-анализ проводили на тройном квадрупольном приборе Perkin Elmer Corp.-Sciex API 300 (Норуолк, Коннектикут), оснащенный интерфейсом APCI. Температуру распылителя оптимизировали для достижения максимальной чувствительности при 350°С. Положительные ионы (m+1) для OX (307,2; Searle Pharmaceutical, Чикаго, Иллинойс) и d 3 T (292,2) вводили во второй квадруполь для индуцированного столкновениями иона. диссоциация. Ионы-продукты 289,2 и 97,0 контролировали и использовали для количественного определения OX и d 3 T соответственно. Концентрации определяли по шеститочечной калибровочной кривой.

Выделение тотальной РНК и качественная ОТ-ПЦР. Тотальную РНК выделяли из образцов биопсии мышц (50–75 мг) с использованием RNAzol B (Tel-Test, Inc., Friendswood, TX). Затем два микрограмма тотальной РНК были преобразованы в ДНК с использованием системы обратной транскрипции (Promega Corp., Мэдисон, Висконсин). Затем ДНК (5 мкл) подвергали ПЦР в присутствии соответствующих праймеров. Продукты ПЦР анализировали на Саузерн-геле, а продукты амплифицированной ДНК определяли по ДНК-лестнице. Затем были сделаны Саузерн-блоты и гибридизованы с олигонуклеотидами фрагмента ДНК.Глицеральдегидфосфатдегидрогеназа (GAP) коамплифицируется в каждом образце в качестве внутреннего контроля. Для AR нижестоящий праймер был включен в реакцию с обратной транскриптазой. Праймеры и олигонуклеотиды гибридизации для IGF-I и AR следующие: IGF-I: смысловой, 5′-AAATCAGCAGTCTTGGAACC-3′; антисмысловая, 5’CTTCTGGGTCTTGGGCATGT 3′; олигонуклеотид, 5′-CAAGCCCACAG-GGTATGGCTCCAGCAGT-3′; AR: смысл, 5′-GATGCTCTACTTCGCCCCTGA-3′; антисмысловой, 5′-CCCAGCAAATAGAATTCCATGAC-3′; олигонуклеотид, 5′-CTGGGTGTGGAAATAGATG-3′; и GAP: смысл, 5′-GGTATCGTGGAAGGACTCAT-3′; антисмысловой, 5′-TCCACCACCCTGT-TGCTGTA-3′; олигонуклеотид, 5′-GTGGGTGTCGCTGTTGAAGT-3′.

Плотность Саузерн-блоттинга измеряли с использованием программы анализа ImageQuant (Molecular Dynamics, Inc., Саннивейл, Калифорния).

Расчеты

Кинетическая модель. Кинетика внутриклеточных свободных аминокислот была описана ранее (16). Однако мы кратко опишем кинетические параметры, составляющие трехпуловую модель кинетики аминокислот ног (рис. 2).

Рисунок 2.

Трехкомпонентная модель кинетики аминокислот в ногах.Пулы свободных аминокислот в бедренной артерии (А), бедренной вене (V) и мышце (М) соединены стрелками , что указывает на однонаправленный поток аминокислот между каждым компартментом. Аминокислоты поступают в ногу через бедренную артерию (F в ) и выходят через бедренную вену (F из ). F V,A – прямое поступление из артерии в вену аминокислот, не попадающих во внутриклеточную жидкость. F M,A и F V,M представляют собой транспорт внутрь и наружу из артерии в мышцу и из мышцы в вену соответственно.F M,O представляет собой появление внутриклеточной аминокислоты в результате протеолиза фенилаланина. F O,M – скорость исчезновения внутриклеточных аминокислот для синтеза белка для фенилаланина.

Рисунок 2.

Трехкомпонентная модель кинетики аминокислот в ногах. Пулы свободных аминокислот в бедренной артерии (А), бедренной вене (V) и мышце (М) соединены стрелками , что указывает на однонаправленный поток аминокислот между каждым компартментом. Аминокислоты поступают в ногу через бедренную артерию (F в ) и выходят через бедренную вену (F из ).F V,A – прямое поступление из артерии в вену аминокислот, не попадающих во внутриклеточную жидкость. F M,A и F V,M представляют собой транспорт внутрь и наружу из артерии в мышцу и из мышцы в вену соответственно. F M,O представляет собой появление внутриклеточной аминокислоты в результате протеолиза фенилаланина. F O,M – скорость исчезновения внутриклеточных аминокислот для синтеза белка для фенилаланина.

Бедренная артерия доставляет (F в ) аминокислоты к ноге, тогда как аминокислоты выводятся через бедренную вену (F из ).Таким образом, эти аминокислоты могут перемещаться между артерией (А), веной (V) и мышцей (М). Транспорт аминокислот внутрь от A к M (F M, A ) и транспорт аминокислот наружу от M к V (F V, M ) происходят через бедренную артерию и вену, соответственно. Таким образом, транспорт тканей внутрь (F в ) и наружу (F из ) рассчитывали следующим образом:

|\mathrm{F}_{\mathrm{in}}{=}\mathrm{C}_{\ mathrm{A}}{\times}\mathrm{BF}$|

|\mathrm{F}_{\mathrm{out}}{=}\mathrm{C}_{\mathrm{V}}{\times}\mathrm{BF}$|

|\mathrm{F}_{\mathrm{M,A}}{=}{\{}{[}(\mathrm{E}_{\mathrm{M}}{-}\mathrm{E} _ {\ mathrm {V}} \ mathrm {) / (E} _ {\ mathrm {A}} {-} \ mathrm {E} _ {\ mathrm {M}}) {]} {\ times} \ mathrm {C} _ {\ mathrm {V}} {+} \ mathrm {C} _ {\ mathrm {A}} {\}} {\ times} \ mathrm {BF} $ |

|\mathrm{F}_{\mathrm{V,M}}{=}{\{}{[}(\mathrm{E}_{\mathrm{M}}{-}\mathrm{E} _ {\ mathrm {V}} \ mathrm {) / (E} _ {\ mathrm {A}} {-} \ mathrm {E} _ {\ mathrm {M}}) {]} {\ times} \ mathrm {C} _ {\ mathrm {V}} {+} \ mathrm {C} _ {\ mathrm {V}} {\}} {\ times} \ mathrm {BF} $ |

, где C A и C V и E A и E V представляют собой концентрации аминокислот и обогащение трассерами в бедренной артерии и вене, а E M представляет собой обогащение мышц.Кровоток в ногах представлен БФ. Аминокислоты, которые обходят мышцу через бедренную артерию, можно рассчитать по одному из следующих выражений:

|\mathrm{F}_{\mathrm{V,A}}{=}\mathrm{F}_{\mathrm{ in}}{-}\mathrm{F}_{\mathrm{M,A}}$|

|\mathrm{F}_{\mathrm{V,A}}{=}\mathrm{F}_{\mathrm{out}}{-}\mathrm{F}_{\mathrm{V,M }}$|

Модель также позволяет рассчитать скорость внутриклеточного появления (F M, O ) аминокислот в результате распада белка и скорость использования аминокислот (F O, M ) для синтеза белка.Внешний вид и утилизация аминокислот рассчитываются по следующим формулам соответственно: \times}(\mathrm{E}_{\mathrm{A}}\mathrm{/E}_{\mathrm{M}}{-}1)$|

|\mathrm{F}_{\mathrm{O,M}}{=}(\mathrm{C}_{\mathrm{A}}{\times}\mathrm{E}_{\mathrm{A }}{-}\mathrm{C}_{\mathrm{V}}{\times}\mathrm{E}_{\mathrm{V}}){\times}\mathrm{BF/E}_{\ матрм{M}}$|

Следующее выражение представляет общую скорость появления (Ra M ) внутриклеточных аминокислот, которая является функцией распада белка (F M, O ) и транспорта внутрь ткани (F M, A ).

|\mathrm{Ra}_{\mathrm{M}}{=}\mathrm{F}_{\mathrm{M,O}}{+}\mathrm{F}_{\mathrm{M,A} }$|

Эффективность синтеза белка (PSE). Используя фенилаланин, мы рассчитали относительную эффективность синтеза белка следующим образом:

|\mathrm{PSE}{=}\mathrm{F}_{\mathrm{O,M}}\mathrm{/(F}_{\ mathrm{M,A}}{+}\mathrm{F}_{\mathrm{M,O}}\mathrm{)}$|

PSE определяется как доля скорости появления внутриклеточных аминокислот, которая включается в мышечные белки, принимая во внимание, что фенилаланин не окисляется в мышцах.Следовательно, F O, M представляет собой количество аминокислот, включенных в мышечные белки. ФСР. Используя традиционный метод предшественник-продукт, мы определили FSR мышечных белков путем измерения скорости включения индикатора фенилаланина в белок и обогащения внутриклеточного пула предшественником

|\mathrm{FSR}{=}{[}( \ mathrm {E} _ {\ mathrm {p2}} {-} \ mathrm {E} _ {\ mathrm {p1}} \ mathrm {)/(E} _ {\ mathrm {M}} {\ times} t ){]}{\times}60{\times}100$|

, где E p1 и E p2 представляют собой обогащение связанного с белком l-[ кольцо 2 H 5 ]фенилаланина в точках отбора проб через 2 и 5 часов.Среднее внутриклеточное обогащение l-[кольцо- 2 H 5 ]фенилаланина составляет E M , тогда как время в минутах представлено как t . Чтобы выразить FSR в процентах в час, выражение затем умножается на коэффициенты 60 (минуты в час) и 100 соответственно.

ФБР. Мы кратко обсудим новый метод измерения фракционного распада белка, который был разработан и подробно описан ранее (9). Кроме того, метод FBR недавно был подтвержден в отчете этой лаборатории (20).В этом методе используется вариант традиционного метода прекурсора-продукта для определения FSR. В этом случае продуктом являются свободные внутриклеточные аминокислоты, а предшественниками — артериальная кровь и белок тканей.

Метод FBR включает остановку обогащения после достижения изотопного равновесия 1-[ 15 N]фенилаланина и определение скорости распада внутриклеточного обогащения аминокислотами. Скорость распада свободного внутриклеточного обогащения определяется артериальным распадом (который продолжает поставлять определенное количество метки во внутриклеточный пул, а также немеченые аминокислоты) и FBR (который обеспечивает остальные немеченые аминокислоты). .{\ mathrm {t} _ {\ mathrm {2}}}} \ mathrm {E} _ {\ mathrm {F}} (t) dt} {\ times} \ \ frac {\ mathrm {T}}} {\ матрм {Q} _ {\ матрм {F}}} $ |

, где P = E F / (E A − E F ) на изотопном плато, E A (t) и E F (t) представляют собой артериальное и внутриклеточное обогащение, а T/Q F – отношение связанной аминокислоты к несвязанной в образце ткани.

Без переменных P и T/Q F в приведенном выше уравнении это просто традиционное уравнение прекурсор-продукт.Традиционное уравнение прекурсор-продукт предполагает, что продукт получен только из одного прекурсора. Однако при определении FBR продукт имеет два источника: аминокислоты плазмы и аминокислоты, связанные с белками. Таким образом, эти два источника представлены переменной P. P равен отношению распада белка к транспорту аминокислот в клетку и рассчитывается путем определения разбавления обогащения аминокислотами между плазмой и внутриклеточным пространством при изотопном равновесном состоянии.

Фактор T/Q F необходим для того, чтобы сделать единицы FBR сопоставимыми с единицами FSR, так что единицы FBR представляют собой скорость распада белка, деленную на размер пула связанных аминокислот. Традиционное уравнение прекурсор-продукт рассчитывает скорость превращения прекурсора в продукт, деленную на размер пула продукта. Однако при FBR скорость распада белка делится на размер пула свободных внутриклеточных аминокислот. Наконец, в этой модели FBR, а также при кинетическом определении скорости появления от распада белка (F M, O ) и исчезновения до синтеза белка (F O, M ) необходимо сделать предположение, что метка не возвращается после распада белка обратно в свободный внутриклеточный пул.Это разумно, учитывая низкое обогащение мышечного пула по сравнению со свободным внутриклеточным обогащением при изотопном равновесии. Таким образом, артериальная кровь остается единственным источником индикатора для свободного внутриклеточного пула. Напротив, немеченые аминокислоты как из артериальной крови, так и из белкового распада вносят свой вклад в свободный внутриклеточный пул.

Статистический анализ. Сравнение исходных условий и условий лечения проводилось с использованием парных тестов t .Статистическая значимость была установлена ​​на уровне P ≤ 0,05. Данные представлены как среднее ± se.

Результаты

Как показано в Таблице 1, стабильное артериальное состояние было достигнуто в течение часа отбора проб (240–300 мин) как в контрольный период, так и через 5 дней введения ОХ. Однако обогащение артерий было значительно выше после лечения OX (таблица 1; P <0,05). Из-за несоблюдения режима лечения одним субъектом все представленные данные включают результаты только пяти субъектов.

Таблица 1.

Обогащение аминокислотами бедренной артерии без содержания аминокислот

Минута инфузии . Фенилаланин .
Контроль (трассер/трассер) . Оксандролон (трассер/след) .
240 240 0,0646 ± 0,0035 0,0759 ± 0,0032 A 8 A
260 0.0640 ± 0,0030 0,0722 ± 0,0016
280 0,0647 ± 0,0038 0,0672 ± 0,0025
300 0,0638 ± 0,0017 0,0715 ± 0,0022
Мин инфузии . Фенилаланин .
Контроль (трассер/трассер) . Оксандролон (трассер/след) .90 428
240 0,0646 ± 0,0035 0,0759 ± 0,0032
260 0,0640 ± 0,0030 0,0722 ± 0,0016
280 0,0647 ± 0,0038 0.0672 ± 0.0025 ± 0,0025
300 300 0,0638 ± 0.0017 0.0715 ± 0.0022 A
Таблица 1.

Бедная артерия Бесплатные аминокислотные обогащения

Мин. . Фенилаланин .
Контроль (трассер/трассер) . Оксандролон (трассер/след) .
240 0,0646 ± 0,0035 0,0759 ± 0,0032
260 0,0640 ± 0,0030 0,0722 ± 0,0016
280 0,0647 ± 0,0038 0,0672 ± 0,0025 а
300 0.0638 ± 0,0017 0,0715 ± 0,0022 a
Мин. инфузии . Фенилаланин .
Контроль (трассер/трассер) . Оксандролон (трассер/след) .
240 240 0,0646 ± 0.0035 0,0759 ± 0,0032 A
260 260 0,0640 ± 0.0030 +0,0722 ± 0,0016
280 0,0647 ± 0,0038 0,0672 ± 0,0025
300 0,0638 ± 0,0017 0,0715 ± 0,0022

Концентрации OX в сыворотке на 3-й день (1,9 ± 0,4 нг/дл) и 5-й день (2,2 ± 0,3 нг/дл) введения OX, измеренные через 10 часов после каждого вечернего перорального приема (2100 часов), оставались стабильными. Однако через 18 часов после лечения на 5-й день уровни ОХ в сыворотке заметно снизились (0,0.48 ± 0,06 нг/дл; P <0,01) по сравнению с 10-часовыми значениями на 3 или 5 день. Общие концентрации тестостерона в сыворотке находились в пределах нормального физиологического диапазона в день 0 (449 ± 35 нг/дл) и день 3 (441 ± 44 нг/дл) лечения ОХ. Однако к 5-му дню концентрация общего тестостерона в сыворотке была значительно снижена (282 ± 45 нг/дл; P <0,05) ниже значений 0-го и 3-го дня (рис. 3). Концентрации свободного тестостерона в сыворотке были в пределах нормального физиологического диапазона на 0, 3 и 5 дни. Однако к 5 дню концентрации свободного тестостерона в сыворотке были значительно снижены (98 ± 10 пг/мл; P <0.001) ниже значений для дня 0 (121 ± 12 пг/мл) и дня 3 (126 ± 9 пг/мл). Следовательно, общая концентрация андрогенов (Т + ОХ) снижалась параллельно снижению Т (рис. 3).

Рисунок 3.

Общая концентрация андрогенов. Общая концентрация Т в сыворотке крови ( заштрихованная часть ) и ОХ ( черная часть ) у пяти молодых мужчин на 0, 3 и 5 дни. ).

Рис. 3.

Общая концентрация андрогенов. Общие концентрации T в сыворотке ( заштрихованная часть ) и OX ( черная часть ) у пяти молодых мужчин на 0, 3 и 5 дни. ).

FSR увеличился с 0,057 ± 0,004% до 0,082 ± 0,008%/ч после 5 дней введения OX (рис. 4; P < 0,05), тогда как FBR остался неизменным (0,138 ± 0,005% против 0,118 ± 0,0000 %/ч, P = 0.40). Появление фенилаланина в организме снизилось с 0,80 ± 0,03 до 0,75 ± 0,03 мкмоль/кг·мин после лечения OX ( P <0,05).

Рисунок 4.

FSR мышечного белка. FSR мышечного белка у пяти молодых мужчин в постабсорбтивном состоянии как до (контроль, , открытая полоса ), так и после (OX, , черная полоса ) введения OX. *, Пять дней приема ОХ увеличили скорость синтеза мышечных белков примерно на 44% ( P < 0.05).

Рис. 4.

FSR мышечного белка. FSR мышечного белка у пяти молодых мужчин в постабсорбтивном состоянии как до (контроль, , открытая полоса ), так и после (OX, , черная полоса ) введения OX. *, Пять дней приема ОХ увеличили скорость синтеза мышечных белков примерно на 44% ( P < 0,05).

Полученные с помощью модели параметры кинетики свободных аминокислот в мышцах ног у пяти субъектов в контрольный период и после 5 дней OX показаны в таблице 2.Обработка OX не влияла на доставку аминокислот в (F в ) или высвобождение меченого фенилаланина из ноги (F из ). Кроме того, скорость внутреннего транспорта (F M, A ) фенилаланина осталась неизменной. Однако введение ОХ в течение 5 дней привело к значительному снижению скорости выведения фенилаланина наружу (F V, M ; P <0,05). Внутриклеточная скорость появления фенилаланина (F M, O ), показатель протеолиза, после введения ОХ не изменилась (табл. 2).Однако, в соответствии с данными прямого включения, скорость внутриклеточного использования фенилаланина для синтеза белка (F O, M ) значительно увеличилась после обработки OX (таблица 2; P <0,05). В результате увеличения F O,M и отсутствия изменений в F M,O чистый баланс (NB) сместился с чистого отрицательного выхода (-30 ± 6) в течение контрольного периода натощак на приблизительный нулевой баланс (-1 ± 4) во время ночного голодания после 5 дней OX (таблица 2; P <0.05). Эффективность синтеза белка значительно увеличилась от контроля к периодам OX (24 ± 0,03% против 39 ± 0,07%; P <0,05). Наконец, ОХ не влиял на кровоток в ногах.

Таблица 2.

Влияние лечения оксандролоном на кинетику свободных аминокислот в мышцах ног у молодых мужчин

Кинетический параметр . Фенилаланин .
Управление . Оксандролон .
F в 39 2 в 39 263 ± 46 227 ± 42
F Out (Венозный отток) 293 ± 46 228 ± 45
F м, (внутренний транспорт) (внутренний транспорт) 9 144 ± 17 124 ± 25
F V, M (внешний транспорт) 175 ± 15 125 ± 29 A
F V, F V, (функциональный шунтирование) 118 ± 35 102 ± 17 102 ± 17
F м, O (пробоя белка) 83 ± 8 69 ± 8
F O, M (Синтез белка) 40 9 53 ± 3 68 ± 5 A
9 RA м (внутриклеточный внешний вид) 228 ± 16 193 ± 32
NB ( чистый остаток)  −30 ± 6 −1 ± 4 a
Кинетический параметр . Фенилаланин .
Управление . Оксандролон .
F в 39 2 в 39 263 ± 46 227 ± 42
F Out (Венозный отток) 293 ± 46 228 ± 45
F м, (внутренний транспорт) (внутренний транспорт) 9 144 ± 17 124 ± 25
F V, M (внешний транспорт) 175 ± 15 125 ± 29 A
F V, F V, (функциональный шунтирование) 118 ± 35 102 ± 17 102 ± 17
F м, O (пробоя белка) 83 ± 8 69 ± 8
F O, M (Синтез белка) 40 9 53 ± 3 68 ± 5 A
9 RA м (внутриклеточный внешний вид) 228 ± 16 193 ± 32
NB ( чистый остаток)  −30 ± 6 −1 ± 4 a
Таблица 2.

Влияние лечения оксандролоном на кинетику свободных аминокислот в мышцах ног у молодых мужчин

Кинетический параметр . Фенилаланин .
Управление . Оксандролон .
F в 39 2 в 39 263 ± 46 227 ± 42
F Out (Венозный отток) 293 ± 46 228 ± 45
F м, (внутренний транспорт) (внутренний транспорт) 9 144 ± 17 124 ± 25
F V, M (внешний транспорт) 175 ± 15 125 ± 29 A
F V, F V, (функциональный шунтирование) 118 ± 35 102 ± 17 102 ± 17
F м, O (пробоя белка) 83 ± 8 69 ± 8
F O, M (Синтез белка) 40 9 53 ± 3 68 ± 5 A
9 RA м (внутриклеточный внешний вид) 228 ± 16 193 ± 32
NB ( чистый остаток)  −30 ± 6 −1 ± 4 a
Кинетический параметр . Фенилаланин .
Управление . Оксандролон .
F в 39 2 в 39 263 ± 46 227 ± 42
F Out (Венозный отток) 293 ± 46 228 ± 45
F м, (внутренний транспорт) (внутренний транспорт) 9 144 ± 17 124 ± 25
F V, M (внешний транспорт) 175 ± 15 125 ± 29 A
F V, F V, (функциональный шунтирование) 118 ± 35 102 ± 17 102 ± 17
F м, O (пробоя белка) 83 ± 8 69 ± 8
F O, M (Синтез белка) 40 9 53 ± 3 68 ± 5 A
9 RA м (внутриклеточный внешний вид) 228 ± 16 193 ± 32
NB ( чистый остаток)  -30 ± 6 -1 ± 4 a  

Введение OX значительно увеличивало концентрацию мРНК AR скелетных мышц без изменения концентрации мРНК IGF-I.На рис. 5 показана репрезентативная авторадиограмма Саузерн-блот-гибридизации для AR скелетных мышц и график данных денситометрии для всех пяти субъектов. Концентрации мРНК ИФР-I существенно не увеличивались после 5 дней лечения ОХ (контроль, 2,3 ± 0,6; ОХ, 3,1 ± 0,5). Концентрация ГАП не изменилась. Данные представлены как отношение плотности полосы AR к плотности полосы GAP.

Рисунок 5.

Концентрации мРНК AR. Верх , Репрезентативная авторадиограмма Саузерн-блот-гибридизации продукта ОТ-ПЦР из тотальной РНК мышечных биопсий трех субъектов, получавших ОХ (15 мг/день в течение 5 дней).GAP использовали в качестве внутреннего контроля. С, контроль; О, ОКС. Внизу , График среднего значения ± SE для всех пяти субъектов. Данные выражены в условных единицах, рассчитанных как отношение плотности полос AR к плотности полос GAP (внутренний контроль). Статистическую значимость определяли парным тестом t (*, P ≤ 0,05).

Рисунок 5.

Концентрации мРНК AR. Верх , Репрезентативная авторадиограмма Саузерн-блот-гибридизации продукта ОТ-ПЦР из тотальной РНК мышечных биопсий трех субъектов, получавших ОХ (15 мг/день в течение 5 дней).GAP использовали в качестве внутреннего контроля. С, контроль; О, ОКС. Внизу , График среднего значения ± SE для всех пяти субъектов. Данные выражены в условных единицах, рассчитанных как отношение плотности полос AR к плотности полос GAP (внутренний контроль). Статистическую значимость определяли парным тестом t (*, P ≤ 0,05).

Обсуждение

Мы исследовали реакцию кинетики мышечного белка на введение ОХ у нормальных молодых мужчин.Мы продемонстрировали, что умеренная доза ОХ, принимаемая в течение 5 дней, стимулировала анаболизм мышечного белка у молодых мужчин. Кроме того, мы впервые продемонстрировали у людей увеличение АР скелетных мышц после анаболического вмешательства. Мышечный анаболизм во время лечения ОКС происходил за счет стимуляции синтеза белка, так как расщепление белка не изменилось. Более того, значительное снижение полученного с помощью модели внешнего транспорта (F V, M ) наряду с рассчитанным увеличением эффективности синтеза белка указывает на повышенное внутриклеточное повторное использование аминокислот.В совокупности эти результаты демонстрируют механизм анаболических свойств OX в скелетных мышцах натощак.

Недавнее исследование, проведенное в нашей лаборатории (7), показало, что через 5 дней после однократной внутримышечной инъекции ТЕ (200 мг) FSR и синтез модельного белка увеличились в 2 раза без изменений FBR. Кроме того, в соответствии с настоящими выводами Ferrando et al. (7) продемонстрировал повышенное использование внутриклеточных аминокислот, показав тесную взаимосвязь между распадом белка и синтезом белка.Хотя наши кинетические данные убедительно подтверждают эти выводы, величина синтетического ответа на ОХ была не такой большой, как на ТЭ. С OX мы обнаружили 44% и 28% увеличение FSR и модельного синтеза белка (F O, M ) соответственно. Эти различия могут объясняться несколькими важными факторами.

В нашем предыдущем исследовании общая концентрация тестостерона увеличилась вдвое по сравнению с физиологической нормой через 2 дня после инъекции ТЕ (2094 ± 561 нг/дл). Кроме того, к 5-му дню Т все еще находился в верхнем физиологическом диапазоне (953 ± 283 нг/дл) и статистически отличался от концентрации тестостерона до инъекции (425 ± 99 нг/дл) (7).Напротив, величина ответа, которую мы обнаружили в концентрации OX в сыворотке, была намного меньше, чем в случае TE. Например, общий уровень OX в сыворотке, измеренный утром через 10 часов после перорального приема, был постоянным на 3 и 5 день, тогда как общая концентрация в сыворотке и концентрация свободного тестостерона значительно снижались с 0 и 3 по 5 день. Уровни андрогенов при лечении ОХ были намного ниже, чем при ТЭ. Хотя общее воздействие андрогенов на скелетные мышцы при ОХ могло быть значительно меньше, чем мы обнаружили ранее при ТЭ, тем не менее наблюдалось увеличение синтеза белка.Это говорит о том, что ОХ может оказывать большее анаболическое влияние на скелетные мышцы, чем ТЭ, тем самым преодолевая снижение концентрации Т.

Дополнительные данные указывают на то, что способ введения и метаболизм анаболического агента могут объяснить величину разницы в синтезе белка при использовании ОХ по сравнению с ТЕ. Например, внутримышечные инъекции ТЕ вводят на липидной основе, так что они могут накапливаться в жировой ткани и медленно высвобождаться, обеспечивая устойчивую продолжительность действия.После внутримышечного введения 200 мг ТЕ уровни тестостерона в сыворотке повышаются и могут достигать супрафизиологического диапазона в течение 24 часов после введения. В течение нескольких недель эти уровни постепенно снижаются до уровня гипогонадизма (21). В настоящем исследовании уровни OX в сыворотке на 5-й день составляли 2,19 нг/дл через 10 ч после перорального приема. Однако к 18 часам уровни OX в сыворотке упали до 0,48 нг/дл, что представляет собой снижение уровня OX в сыворотке на 78% всего за 8 часов. Из-за такого быстрого снижения уровня ОХ в крови может быть оправдано введение ОХ два раза в день для поддержания более высоких устойчивых уровней общего андрогена в крови, что, возможно, еще больше усилит его анаболический эффект на скелетные мышцы.

Более того, мощного синтеза белка ОХ было достаточно, чтобы улучшить чистый отток аминокислот и катаболизм белка, связанный с ночным голоданием. Учитывая, что у большинства пациентов с травмами и ожогами наблюдается острый гиперкатаболизм, а у большинства больных раком и СПИДом — хронический катаболизм, способность обращать вспять неизбежные потери мышечной массы тела с помощью перорального анаболического агента имеет значительные клинические последствия. Однако временные рамки, необходимые для прироста белка в этих группах пациентов, неизвестны.Как минимум, эффективное повторное использование внутриклеточных аминокислот необходимо для постоянного поддержания метаболического состояния (7, 22). Мы знаем, что во время голодания распад белка обычно намного выше, чем синтез белка (16, 22). Несмотря на голодание в течение ночи, у всех испытуемых было повышенное повторное использование аминокислот, так как внешний транспорт (F V, M ) снизился на 28% после лечения OX. Кроме того, мы показали увеличение эффективности синтеза белка на 65% с помощью OX. В сочетании это может привести к увеличению мышечной массы тела в сытом состоянии.

Андрогены вызывают свой специфический ответ через AR, который, в свою очередь, регулирует транскрипцию андроген-чувствительных генов-мишеней. Хотя мы знаем, что накопление ДНК необходимо для роста мышц, механизмы индуцированной андрогенами аккреции ДНК в скелетных мышцах неясны. AR (23) и мРНК AR (24) были обнаружены в скелетных мышцах человека. Однако на сегодняшний день нет исследований на людях, в которых изучалась бы реакция АР скелетных мышц на воздействие андрогенов. Более того, было высказано предположение, что предшествующее воздействие андрогенов на клетки может каким-то образом подготовить эти клетки к действию вторичных агентов, таких как IGF-I.Поэтому вторичной целью этого исследования было изучение влияния введения ОХ на концентрацию мРНК IGF-I и AR.

Недавнее исследование на тренирующихся крысах показало, что рост скелетных мышц может зависеть от увеличения количества АР (25). Иноуэ и др. (25) исследовали физиологическое значение увеличения АР в гипертрофии мышц, вызванной физической нагрузкой. Они определили, что андрогенный путь оказывает значительное влияние на мышечную гипертрофию, вызванную физическими упражнениями, и обнаружили, что гипертрофия связана с увеличением количества АР в тренируемых мышцах (25).Более того, исследование, проведенное Doumit et al. (26) обнаружили, что предварительная обработка сателлитных клеток свиньи Т в течение 24 часов повышала уровень АР, но не изменяла чувствительность этих клеток к ИФР-1 или другим факторам роста. Точно так же мы обнаружили повышенную экспрессию мРНК AR без изменения концентрации мРНК im IGF-I после краткосрочного введения OX. Эти данные наряду с нашими выводами о повышении концентрации мРНК AR при кратковременном воздействии OX подтверждают утверждение о том, что AR могут прямо или косвенно регулировать накопление ДНК, необходимое для роста мышц.

Более свежие данные подтверждают взаимодополняющую роль андрогенов, АР и ИФР-1. Городской и др. (5) обнаружили повышение концентрации мРНК IGF-I в скелетных мышцах пожилых мужчин, получавших заместительную дозу ТЕ в течение 4 недель. Кроме того, вызывая тяжелый дефицит андрогенов у молодых мужчин в течение 10 недель, Mauras et al. (27) показали заметное снижение концентрации мРНК IGF-I и предположили, что в тканях скелетных мышц андрогены необходимы для локальной продукции IGF-I, независимо от продукции GH и системных концентраций IGF-I.Кроме того, новые данные этого исследования мужчин с дефицитом андрогенов показывают, что АР значительно снижаются в ответ на тяжелый гипогонадизм (28). Хотя нет прямых доказательств того, что OX связывается с AR, результаты настоящего исследования и результаты, о которых сообщают Hayes et al. (28) предполагают, что андрогены могут действовать непосредственно через рецепторы андрогенов, оказывая влияние на белковый метаболизм. Тем не менее, из настоящего исследования мы не знаем физиологического значения повышенной экспрессии мРНК для АР.

Таким образом, это исследование демонстрирует, что ОХ, вводимый один раз в день в умеренной дозе (15 мг/день), способствует чистому синтезу мышечного белка. Более того, эти данные предполагают, что OX индуцирует увеличение экспрессии AR как механизм увеличения чистого синтеза мышечного белка.

Исследователи выражают благодарность медсестрам и персоналу Общеклинического исследовательского центра Медицинского отделения Техасского университета за их помощь в этом проекте, Лакшми Макрей за поддержку медсестер, Чжи Пинг Донг и Боро Старчевич за анализ образцов, а также компанию BTG Pharmaceuticals Co., Inc., за предоставление исследуемого препарата.

1

Бродский

ИГ

,

Балагопал

П

, Наир КС.

1996

Влияние заместительной терапии тестостероном на мышечную массу и синтез мышечного белка у мужчин с гипогонадизмом – исследование клинического исследовательского центра.

J Clin Endocrinol Metab

.

81

:

3469

3469

3475

.2

Katznelson

L

,

kinkelstein

JS

,

Schoenfeld

DA

,

Rosenthal

Di

,

Anderson

EJ

, Klibanski А.

1996

Увеличение плотности костной ткани и безжировой массы тела на фоне введения тестостерона у мужчин с приобретенным гипогонадизмом.

J Clin Endocrinol Metab

.

81

:

4358

4358

4365

.3

Bhasin

S

,

Storer

TW

,

BERMAN

N

, et al.

1997

Замена тестостерона увеличивает безжировую массу и размер мышц у мужчин с гипогонадизмом.

J Clin Endocrinol Metab

.

82

:

407

413

.4

Tenover JS.

1992

Влияние добавок тестостерона на стареющих мужчин.

J Clin Endocrinol Metab

.

75

:

1092

1092

1098

.5

Urban

RJ

,

Bodenburg

C

,

Gilkison

C

, et al.

1995

Назначение тестостерона пожилым мужчинам увеличивает силу скелетных мышц и синтез белка

.

Am J Physiol.

269

:

E820

E826

E826

.6

Grinspoon

S

,

Corcoran

C

,

Lee

K

, et al.

1996

Потеря безжировой массы тела и мышечной массы коррелирует с уровнем андрогенов у мужчин с гипогонадизмом и синдромом приобретенного иммунодефицита.

J Clin Endocrinol Metab

.

81

:

4051

4051

4058

.7

. 70002

AA

,

AA

,

KD

,

Дойл

D

,

Phillips

SM

,

Cortiella

J

,

Вулф

руб.

.

1998

Инъекция тестостерона стимулирует общий синтез белка, но не транспорт аминокислот в ткани

.

Am J Physiol.

275

:

E864

E864

E871

.8

GRIGGS

RC

,

Kingston

W

,

jozefowicz

RF

,

HERR

BE

,

Forbes

G

, Halliday D.

1989

Влияние тестостерона на мышечную массу и синтез мышечного белка.

J Appl Physiol

.

66

:

498

498

503

.9

Чжан

x-J

,

Chinkes

DL

,

Sakurai

Y

,

Wolfe

RR

.

1996

Изотопный метод измерения скорости фракционного распада мышечного белка in vivo

.

Am J Physiol.

270

:

E759

E759

.10

Berger

JR

,

Pall

L

,

,

CD

,

Simpson

DM

,

Berry

PS

, Дадли Р.

1996

Оксандролон при СПИД-истощающей миопатии.

СПИД

.

10

:

1657

1657

1662

.11

.11

Demling

RH

, Desanti L.

1997

Оксандролон и анаболический стероид, значительно увеличивает скорость увеличения веса в фазе восстановления после основных ожогов.

J Травма

.

43

:

47

51

.12

51

.12

Wilson

DM

,

MCCAULEY

E

,

BROWN

DR

, DUDLEY R.

1995

Терапия оксандролоном при конституциональной задержке роста и полового созревания. Совместная исследовательская группа корпорации Bio-Technology General Corporation.

Педиатрия

.

96

:

1095

1095

1000

.13

Rosenfeld

RG

,

attie

км

,

Frane

J

, et al.

1998

Терапия гормоном роста при синдроме Тернера: благотворное влияние на рост взрослых.

J Педиатр

.

132

:

319

319

324

.14

Fenichel

G

,

G

,

Pestronk

A

,

Флоренция

J

,

Robison

V

, Hemlelt V.

1997

Благоприятный эффект оксандролона при лечении мышечной дистрофии Дюшенна: экспериментальное исследование.

Неврология

.

48

:

1225

1225

1226

.15

Biolo

G

,

Chinkes

D

,

Zhang

x

, Wolfe Rr.

1992

Новая модель для определения in vivo связи между трансмембранным транспортом аминокислот и кинетикой белков в мышцах.

J Parenter Enteral Nutr

.

16

:

305

305

315

.16

Biolo

G

,

G

,

Fleming

RYD

,

Maggi

SP

,

Wolfe

RR

.

1995

Трансмембранный транспорт и внутриклеточная кинетика аминокислот в скелетных мышцах человека

.

Am J Physiol.

268

:

E75

E84

.17

Вульф

RR

.

1992

Радиоактивные и стабильные изотопы-индикаторы в биомедицине: принципы и практика кинетического анализа.

Нью-Йорк

:

Уайли-Лисс.

18

Bergstrom

J

,

J

,

L

,

Noree

L-O

, Виннар E.

1974

Внутриклеточная свободная концентрация аминокислоты в ткани мышц человека.

J Appl Physiol

.

36

:

693

693

.19

Calder

Calder

AG

,

Anderson

SE

,

I

,

MCNURLAN

MA

, GARLICK PJ.

1992

Определение низкого обогащения d 5 -фенилаланином (избыток 0,002–0,09 атомных процентов) после превращения в фенилэтиламин в связи с исследованиями белкового обмена с помощью газовой хроматографии/масс-спектрометрии с электронной ионизацией.

Rapid Commun Mass Spectr

.

6

:

421

424

424

.20

Phillips

SM

,

KD

,

AARSLAD

A

,

Wolf

SE

,

Wolfe

RR

.

1997

Смешанный синтез и расщепление мышечного белка после упражнений с отягощениями у людей

.

Am J Physiol.

273

:

E99

E107

.21

Сокол

РЗ

,

Паласиос

А

,

Кэмпфилд

ЛА

,

Саул

С

, Свердлофф .

1982

Сравнение кинетики инъекционного тестостерона у эугонадных и гипогонадальных мужчин.

Fertil Steril

.

37

:

425

430

.22

Биоло

G

,

Флеминг

D

, Wolfe RR.

1998

Физиологическая гиперинсулинемия стимулирует синтез белка и усиливает транспорт отдельных аминокислот в скелетных мышцах человека.

Дж Клин Инвест

.

95

:

811

811

.23

819

.23

Kimura

N

,

Mizokami

A

,

Oonuma

T

,

Sasano

H

, Nagura H.

1993

Иммуноцитохимическая локализация рецептора андрогена поликлональными антителами в тканях человека, залитых парафином.

J Гистохим Цитохим

.

41

:

671

678

.24

Chang

C

,

Kokontis

J

, Liao S.

1988

Структурный анализ комплементарной ДНК и аминокислотных последовательностей андрогенных рецепторов человека и крысы.

Proc Natl Acad Sci USA

.

85

:

7211

7211

7215

.25

INOUE

K

,

K

,

Yamasaki

S

,

Fushiki

T

,

OKADA

Y

, SUGIMOTO E.

1994

Антагонист рецепторов андрогенов подавляет вызванную физической нагрузкой гипертрофию скелетных мышц.

Eur J Appl Physiol

.

69

:

88

91

.26

Doumit

ME

,

Cook

DR

, Merkel RA.

1996

Тестостерон активирует андрогенные рецепторы и снижает дифференцировку свиных миогенных сателлитных клеток in vitro .

Эндокринология

.

137

:

1385

1385

1394

.27

Mauras

N

,

N

,

Hayes

V

,

Welch

S

, et al.

1998

Дефицит тестостерона у молодых мужчин: заметные изменения кинетики белков всего тела, силы и ожирения.

J Clin Endocrinol Metab

.

83

:

1886

1892

.28

Hayes V, Jiang J, Urban RJ, Mauras N. IGF-I и андрогенные стероиды: синергетические эффекты у человека [Аннотация].Протокол 81-го ежегодного собрания The Endocrine Soc. 1999. с. 571.

Copyright © 1999 Эндокринное общество

Стероид увеличивает сухую мышечную массу у ВИЧ-позитивных мужчин, но имеет побочные эффекты американское исследование, опубликованное в мартовском выпуске

журнала синдромов приобретенного иммунодефицита .Однако, хотя стероид увеличивал мышечную массу, он не улучшал выносливость и вызывал побочные эффекты, в том числе повышение уровня «плохого» холестерина ЛПНП и повышение уровня ферментов печени.

Непреднамеренная потеря всего 3% массы тела связана с более низкой выживаемостью у ВИЧ-положительных людей. Хотя использование антиретровирусной терапии привело к значительному снижению распространенности непреднамеренной потери веса, она по-прежнему распространена даже среди людей, получающих лечение от ВИЧ.

Диета и стимуляция аппетита могут помочь увеличить вес у людей, пострадавших от истощения, связанного с ВИЧ, но большая часть прибавки в весе происходит за счет жира, а запасы жира в организме не коррелируют с улучшением выживаемости у ВИЧ-позитивных людей. Некоторые небольшие исследования показали, что анаболические стероиды могут увеличить массу тела и мышечную массу у ВИЧ-позитивных пациентов. Чтобы дополнительно изучить преимущества лечения анаболическими стероидами, исследователи разработали двойное слепое плацебо-контролируемое исследование, в котором мужчины с ВИЧ-ассоциированным истощением были рандомизированы для получения плацебо или одной из суточных доз 20 мг, 40 мг или 80 мг перорального стероида. оксандролон.Исследователи измеряли изменения веса, состава тела, выносливости пациентов, а также проводили лабораторные тесты для оценки безопасности лечения стероидами. В течение первых двенадцати недель мужчин лечили вслепую. В конце этого периода всем мужчинам была предоставлена ​​возможность открытого приема оксандролона в дозе 20 мг в день в течение следующих двенадцати недель.

Глоссарий

плацебо

Таблетка или жидкость, которая выглядит и на вкус точно такая же, как настоящий наркотик, но не содержит активного вещества.

двойной слепой

Клиническое исследование, в котором ни исследователи, ни участники не знают, какое назначенное лечение получает отдельный участник исследования, до окончания исследования. Это снижает риск необъективных результатов.

аланинаминотрансфераза (АЛТ)

Фермент, содержащийся главным образом в печени. Аланинаминотрансферазу можно измерить как часть функционального теста печени. Аномально высокие уровни АЛТ в крови являются признаком воспаления печени или повреждения от инфекции или лекарств.

анаболический

Анаболические процессы строят органы и ткани, включая рост и минерализацию костей и увеличение мышечной массы. Анаболические стероиды представляют собой синтетические формы мужских половых гормонов.

Исследование проводилось в период с осени 1996 г. по лето 1998 г. Лечение антиретровирусными препаратами не было обязательным условием для включения в исследование, но если человек проходил лечение против ВИЧ, он должен был принимать стабильный режим не менее шести недель.Исследователи не указывают, сколько пациентов принимали антиретровирусную терапию, а также не анализируют свои результаты в зависимости от использования антиретровирусных препаратов, что затрудняет определение применимости этих результатов к пациентам, испытывающим истощение, связанное с ВИЧ, несмотря на антиретровирусную терапию.

Всего в исследовании приняли участие 262 мужчины. Количество клеток CD4 было сопоставимо в четырех группах исследования и составляло приблизительно 250 клеток/мм 3 , а вирусная нагрузка составляла приблизительно 120 000 копий/мл.

Масса тела значительно увеличилась во всех группах исследования, включая группу плацебо во время двойной слепой фазы (p

Кроме того, исследователи обнаружили, что пациенты, получавшие 40 мг (p = 0,0049) и 80 мг (p = 0,0002) дозы оксандролона вызывали значительные изменения в массе клеток тела по сравнению с пациентами, получавшими плацебо.

Однако лечение стероидом не привело к улучшению выносливости.

Исследователи отметили, что уровни печеночных ферментов АСТ и АЛТ повышались в течение первых четырех-восьми недель у пациентов, получавших оксандролона в дозах 40 и 80 мг.Более того, они обнаружили дозозависимое увеличение частоты умеренных и тяжелых нарушений функции печени у людей, принимающих стероид. Это было диагностировано с помощью лабораторных анализов, в которых рассматривались уровни АСТ, АЛТ, билирубина и мочевой кислоты. Анализ также показал, что у людей, принимавших стероид в дозах 40 и 80 мг, значительно чаще, чем у тех, кто принимал плацебо, наблюдалось повышение уровня «плохого» холестерина ЛПНП (p

По завершении двенадцатинедельной двойной слепой фазы В ходе исследования всем пациентам была предложена возможность остаться в исследовании еще на двенадцать недель и получать открытую дозу оксандролона 20 мг в день.К концу этого периода различий в весе между пациентами не было, а функция печени перестала существенно отличаться от исходного уровня.

«Лечение оксандролоном было связано со значительно большим увеличением массы тела по сравнению с плацебо. Большая часть прибавки в весе произошла за счет худощавого тела», — комментируют исследователи, которые отмечают, что их исследование было «крупнейшим рандомизированным плацебо-контролируемым исследованием андрогенов у пациентов с ВИЧ-ассоциированной потерей веса».”

Хотя исследователи отмечают, что лечение стероидом в целом «хорошо переносилось», они отмечают, что более чем у 5% пациентов наблюдалось умеренное или серьезное повышение уровня ферментов печени и что «уровень ЛПНП снизился, а уровень ЛПВП увеличился».

Они рекомендуют «дальнейшие исследования… для определения эффективности оксандролона в улучшении мышечной силы, физических функций и качества жизни, связанного со здоровьем, у ВИЧ-инфицированных пациентов с потерей веса».

Ссылки

Грюнфельд С. и соавт. Оксандролон в лечении связанной с ВИЧ потери веса у мужчин: рандомизированное двойное слепое плацебо-контролируемое исследование . J Acquir Immune Defic Syndr 41: 304 – 314, 2006.

Дозировка Anavar для мужчин, женщин и бодибилдеров

Anavar является универсальным соединением. Хотя большинство людей используют Анавар для поддержания мышечной массы при гипокалорийной диете, его можно использовать и для многих других целей. Анавар имеет силу 3-кратного тестостерона, что позволяет использовать его в качестве средства для набора массы или увеличения объема.Анавар обладает нулевой эстрогенной активностью, что является значительным преимуществом перед наполнителями, такими как Дианабол.

Дозировки среднего женского Анавара

Anavar является одним из анаболических стероидов, которые женщины могут безопасно использовать. Гормон Оксандролон безопаснее большинства анаболических стероидов. Он имеет низкий уровень вирилизации, что является общей проблемой, с которой сталкиваются женщины при использовании дополнительных стероидов. Дозировка Анавара в диапазоне от 10 мг до 20 мг будет приемлемой для большинства женщин. Часто это все, что им нужно.Через 6-8 недель большинство женщин могут принимать 10 мг в день. Однако, если они чувствительны к вирилизирующему эффекту, некоторым женщинам, возможно, придется сократить потребление наполовину и принимать по 10 мг через день. Несмотря на то, что Оксандролон имеет низкий процент вирилизации, он все же может вызывать проблемы у очень чувствительных женщин.

Дозы Анавара могут достигать 10 мг в день. Женщины, которые нуждаются в большем количестве, могут терпеть 20 мг в день. Тем не менее, они должны знать, что побочные реакции могут усиливаться при более высоких дозах. Независимо от того, сколько вы принимаете, вы должны немедленно прекратить его использование, если у вас возникнут какие-либо побочные эффекты.Негативные симптомы быстро исчезнут, если вы прекратите использование препарата при первых признаках неприятностей. У вас может возникнуть постоянная проблема, если вы проигнорируете симптомы и продолжите употребление.

Средняя мужская дозировка Anavar

Хотя оксандролоновый гормон можно использовать для набора массы, оксандролоновый гормон также может быть полезен для циклов сушки. Дозировки Анавара для этой цели обычно составляют от 50 до 80 мг в день. Анавар можно использовать в более низких дозах, таких как дозировка 30 мг в день, чтобы помочь в циклах твердого сушки.Не следует ожидать, что этот мягкий стероид будет производить много. Суточная доза 30 мг идеальна для спортсменов, которые хотят получить спортивный импульс.

Дозы Анавара безопасно превышать 100 мг в день, при этом нормальным диапазоном является от 50 до 80 мг. Есть две вещи, которые нам нужно помнить. Гормон Оксандролон может быть дорогим. Таблетки гормона Оксандролон по 10 мг могут стоить от 2 до 5 долларов за штуку, в зависимости от того, где они куплены и какой марки. Дозы Анавара более 100 мг не будут иметь никакого значения.Гормон Оксандролон, кажется, имеет точку быстрого падения после отметки 100 мг. Вы можете заметить некоторое улучшение, если превысите 100 мг, но этого недостаточно, чтобы оправдать цену, которую вы заплатите.

Дозировка тестостерона для бодибилдинга

Рекомендуемая доза тестостерона составляет от 60 до 300 мг в неделю. Недавнее исследование показало, что дозы тестостерона варьировались на разных уровнях: 50 мг, 100 мг, 125 мг, 300 мг, 300 мг, 600 мг и 300 мг каждую неделю.

Результаты показали, что увеличение силы было пропорционально дозировке.Идеальная доза для роста мышц составляла 125 мг на семейн.

Согласно исследованию, инъекционный тестостерон может быть более эффективным для увеличения силы, чем оральный тестостерон.

Курс Анавара и Тестостерона

Не рекомендуется женщинам, так как тестостерон может вызывать побочные эффекты, приводящие к вирилизации у женщин.

Можно начать с тестостерона, если вы ищете стероид, подходящий для начинающих.

С точки зрения соотношения риск/вознаграждение, тестостерон — лучший стероид, который вы можете принимать.

Это приведет к значительному увеличению силы и мышечной массы, что делает его стероидом для набора массы.

Не вызывает значительной нагрузки на сердце по сравнению с другими стероидами. Кроме того, это инъекционный препарат, поэтому он не нагружает печень. Эти два атрибута имеют решающее значение для вашего здоровья.

Побочные эффекты сочетания анавара с тестостероном, вероятно, будут сильнее. Уровень холестерина, вероятно, немного повысится, если вы будете принимать одновременно анавар и тестостерон. Этот дуэт также может вызывать побочные эффекты, такие как жирная кожа, прыщи и истончение волос (на коже головы).

Это различные виды инъекционного тестостерона:

  • Испытательная подвеска
  • Тест ципионат
  • Попробуйте энантат
  • Тестовый ацетат
  • Тестовый пропионат
  • Сустанон 250

Стероид тот же, но эфиры разные. Это может повлиять на то, как быстро он всасывается или как долго он остается в организме. Из-за простоты введения и цены энантат является наиболее популярной формой теста.

Сколько времени в среднем требуется Анавару для работы?

Анавар

действует очень быстро из-за короткого периода полувыведения (9-10 часов). Пользователи Anavar обычно замечают значительную разницу в течение первых двух недель.
Но то, что уровень тестостерона в сыворотке быстро повышается в кровотоке, не обязательно означает, что вы сразу же почувствуете выдающиеся результаты.

Анавар — мягкий, не вызывающий сонливости стероид. Анавар — это мягкий пероральный стероид, который действует быстро (с периодом полувыведения 3-6 часов).Благодаря своей большей силе дианабо может привести к удивительному увеличению мышечной массы всего за 10 дней.

Женщины, которые принимают 10 мг анавара в день, заметят рост мышц в течение первых 10 дней. Женщина, которая принимает 10 мг анавара в день, испытает более сильный эффект, чем мужчина, который принимает 20 мг в день. Это потому, что мужчины производят в 20 раз больше тестостерона (37), чем женщины. Поэтому они более открыты для воздействия тестостерона.

Анавар Результаты

Истинная сила Анавара заключается в его способности сохранять мышечную ткань и сжигать жир во время фазы сушки.Анавар может увеличить сжигание жира и дать вам плотное, мускулистое тело с большим кровотоком.

Вы можете ожидать следующие потенциальные результаты к концу и во время цикла:

  • Потеря веса (потеря жира) без воздействия на мышечную ткань может быть достигнута на этапах диеты.
  • Мышцы более четкие, сильные и плотные.
  • Более подтянутое тело и меньшее количество жира увеличат кровоснабжение.

Почему жидкий анавар так популярен

Жидкие формы стероидов имеют более высокую скорость абсорбции, чем их аналоги в таблетках.Это основное преимущество. Нельзя сказать, что Анавар, Винстрол и Дианабол принесут вам меньше пользы. Просто спортсмены хотят более быстрых результатов, поэтому они предпочитают жидкости твердым формам.

Решающим фактором при выборе является цена пероральных и инъекционных растворов. Стоимость пероральных растворов меньше инъекционных, поэтому этот фактор часто влияет на решение. Многие спортсмены также предпочитают самостоятельно изготавливать жидкий Анавар и другие стероиды, что помогает снизить стоимость.Инъекции, однако, требуют большего количества расчетов и больших вложений во вспомогательные ингредиенты.

Оксандролон усиливает печеночный кетогенез у взрослых мужчин

Ключевые слова

ВВЕДЕНИЕ

Анаболические стероиды стимулируют экспрессию печеночной липазы (HL). 1,2 Печеночная липаза обладает как фосфолипазной, так и триглицерид-липазной активностью. Увеличение активности HL сопровождается снижением уровня холестерина липопротеинов высокой плотности (HDL-C) в плазме; это увеличение, по-видимому, дополнительно усиливает липолиз липопротеинов, богатых триглицеридами (TGRLP), и способствует поглощению остаточных липопротеинов в печени. 2-4 Из-за влияния анаболических стероидов на HL мы поставили вопрос, может ли повышенный липолиз TGRLP на поверхности клеток печени увеличить приток жирных кислот в печень. В качестве первого шага для изучения этой возможности мы также спросили, могут ли анаболические стероиды способствовать печеночному кетогенезу, который может быть вторичным по отношению к увеличению притока жирных кислот в печень и усиленному окислению жирных кислот. Поскольку точная количественная оценка окисления жирных кислот у людей невозможна, мы измерили уровни 3-гидроксибутирата в плазме в качестве суррогатного индикатора.Предыдущие исследования показали, что 3-гидроксибутират плазмы коррелирует со скоростью кетогенеза, которая, в свою очередь, коррелирует со скоростью окисления жирных кислот. 5-8 Если печеночный кетогенез во время приема анаболических стероидов не увеличивается, то увеличение поступления жирных кислот в печень маловероятно.

МЕТОДЫ

Восемнадцать взрослых мужчин были привлечены к исследованию в Медицинском центре по делам ветеранов в Далласе. Их характеристики приведены в таблице 1.У девяти субъектов был метаболический синдром, как определено ранее. 9 ​​ Базальный уровень триглицеридов в плазме колебался от 51 мг/дл до 340 мг/дл, уровень холестерина липопротеинов низкой плотности колебался от 80 мг/дл до 182 мг/дл и ХС-ЛПВП от 19 мг/дл до 74 мг/дл. дл. Никто не принимал гиполипидемические препараты, и ни у кого не было в анамнезе сердечно-сосудистых заболеваний, эндокринных нарушений, дисфункции печени или противопоказаний для участия в исследовании. Испытание имело последовательный дизайн исходной оценки с последующим пероральным приемом оксандролона (10 мг/сут) в течение 7 дней с повторением исходных тестов.Протокол был одобрен Институциональным наблюдательным советом по исследованиям на людях, и все субъекты дали информированное письменное согласие.

ТАБЛИЦА 1.

Клинические характеристики субъектов

Субъекты прошли клиническую оценку для включения в исследование, а после набора у них была проведена антропометрия, измерение липидов плазмы натощак и холестерина липопротеинов, а также исследование кетогенеза во время расширенного теста на переносимость жиров ( ФТТ). В последнем случае после ночного голодания испытуемые выпивали густой напиток из взбитых сливок, содержащий 75 г жира (100% калорий из жира с 70% длинноцепочечных насыщенных веществ).После приема сливок им разрешалось пить воду и чай без сахара в течение следующих 10 часов. Образцы артериализованной крови получали в натрий-этилендиаминтетрауксусной кислоте (2 мг/мл) до ( t = 0) и каждые 2 часа до 8 часов после еды. Субъекты держали руку в изотермическом боксе ( T = 70°C) для получения образцов артериализованной крови. Чтобы избежать продолжающегося липолиза in vitro под действием липопротеинлипазы плазмы, образцы крови немедленно помещали на лед, центрифугировали для отделения плазмы, которая была заморожена при -80°C.Анализ был проведен менее чем за 24 часа. В предварительном тестировании мы продемонстрировали, что до анализа в этих условиях не происходило значительного липолиза триглицеридов. 3-гидроксибутират, неэстерифицированные жирные кислоты (NEFA), триглицериды и глицерин измеряли в плазме спектрофотометрически с использованием ферментативных анализов (Roche Diagnostics/Boehringer Mannheim Corp, Indianapolis IN). Уровни общего холестерина, триглицеридов и HDL-C в плазме измеряли с использованием стандартизированных ферментативных анализов, как описано ранее. 10 Уровни аполипопротеина B в плазме определяли количественно, как описано ранее. 11

Данные суммированы как среднее ± SEM. Первичной конечной точкой исследования было изменение площади под кривой (AUC) 3-гидроксибутирата плазмы во время удлиненной FTT до и через 7 дней лечения оксандролоном. Влияние оксандролона на интересующие метаболиты анализировали путем сравнения исходного уровня с уровнями лечения во время голодания или AUC во время расширенного FTT.Анализ проводили путем повторных измерений дисперсионного анализа с поправкой Бонферрони-Данна на множественность испытаний. Площади под кривой вычислялись по формуле трапеций. Для анализа данных использовалась программа StatView (версия 5.0.1) от SAS.

РЕЗУЛЬТАТЫ

Во время лечения оксандролоном у мужчин наблюдалось ожидаемое заметное снижение ХС-ЛПВП (39 ± 3 [SEM] мг/дл против 26 ± 2 мг/дл [ P < 0,001]). Уровни холестерина липопротеинов низкой плотности не изменились (131 ± 7 мг/дл против 136 ± 8 мг/дл).Как показано на рисунке 1, терапия оксандролоном не вызывала изменений ни в уровнях натощак, ни в постпрандиальных AUC для триглицеридов плазмы, глицерина или НЭЖК. Напротив, уровни 3-гидроксибутирата натощак во время лечения оксандролоном повышались на 70% (рис. 2), а оксандролон повышал AUC для 3-гидроксибутирата на 53% после оральной жировой нагрузки. Наблюдалась последовательная направленность изменения уровня 3-гидроксибутирата при терапии оксандролоном, несмотря на значительные исходные различия в уровнях NEFA среди участников исследования.Это привело к статистически значимому повышению уровня 3-гидроксибутирата при лечении оксандролоном (рис. 2).

РИСУНОК 1.

Влияние оксандролона на уровни в плазме крови натощак и постпрандиальные уровни триглицеридов (панели A и B соответственно), неэтерифицированных жирных кислот (панели C и D соответственно) и глицерина (панели E и F соответственно) ). Термин исходный уровень означает исследование до лечения оксандролоном и оксандролон во время лечения. Не было никаких существенных изменений уровней ни натощак, ни после приема пищи для любого из метаболитов между исходными измерениями и измерениями во время лечения.Численные данные, показанные на рисунке, представляют собой средние значения ± стандартная ошибка средних значений.

РИСУНОК 2.

Влияние оксандролона на уровни 3-гидроксибутирата натощак (панель A) и во время расширенного теста на толерантность к жирам (панель B). Результаты показаны в виде графиков типа «ящик с усами». Численные данные, показанные на рисунке, представляют собой средние значения ± стандартная ошибка средних значений. Термин исходный уровень означает исследование до лечения оксандролоном и оксандролон во время лечения. Терапия оксандролоном значительно увеличивала уровни 3-гидроксибутирата натощак и после приема пищи при повторном ANOVA после поправок Бонферрони-Данна на множественность тестов ( P < 0.0028 для панели A и P <0,0086 для панели B).

ОБСУЖДЕНИЕ

В текущем исследовании терапия оксандролоном сопровождалась поразительным повышением уровня 3-гидроксибутирата в плазме. Это изменение почти наверняка отражает усиление печеночного кетогенеза 5-8 и поднимает вопрос о механизме. Можно рассмотреть несколько возможностей.

Во-первых, повышенный печеночный кетогенез может быть вторичным по отношению к повышенному притоку жирных кислот в печень, связанному с повышенной активностью HL.Фактически, как сообщалось ранее, 1,2,12 мы наблюдали заметное снижение уровня HDL-C в плазме, связанное с приемом анаболических стероидов. В текущем исследовании снижение HDL-C было равномерным, в среднем около 33%. Снижение уровня ХС-ЛПВП произошло у субъектов, которые даже имели низкий исходный уровень ЛПВП до приема оксандролона. На основании предыдущих исследований 1,2,12 мы предполагаем, что дальнейшее снижение уровня ХС-ЛПВП на фоне приема оксандролона было следствием повышения активности ГЛ.Повышение липолитической активности на поверхности гепатоцитов может привести к большему притоку жирных кислот в печень. Потенциальные субстраты липопротеинов для активности HL были изучены, но полностью не решены. Субстратами могут быть липопротеины высокой плотности и TGRLP, включая липопротеины очень низкой плотности и хиломикроны и их остатки. Большинство результатов основаны на исследованиях in vitro и не дают определенной информации о том, что на самом деле происходит на поверхности клетки печени.Однако существует возможность липолиза и высвобождения жирных кислот из нескольких типов липопротеинов. Эти жирные кислоты могут быть источником окисления жирных кислот.

Другим возможным механизмом повышенного окисления жирных кислот при терапии оксандролоном может быть усиленное поглощение циркулирующих НЭЖК печенью. Некоторые исследователи показали, что анаболические стероиды незначительно повышают активность липопротеинлипазы плазмы. 13 Тем не менее, в этом исследовании не было отмечено повышения ни НЭЖК, ни глицерина в постпрандиальном состоянии.Это открытие говорит против возможности того, что оксандролон усиливает периферический липолиз за счет ЛПЛ и повышает доступность НЭЖК для поглощения печенью. Кроме того, отсутствие повышения NEFA натощак при терапии оксандролоном не подтверждает возможность того, что стероид усиливал липолиз жировой ткани. И наоборот, отсутствие снижения НЭЖК натощак при приеме оксандролона не поддерживает повышенное окисление жирных кислот в мышцах, которое могло бы вызвать повышенное поглощение НЭЖК мышцами.

Другая возможность, которую нельзя исключать, заключается в том, что оксандролон непосредственно способствует окислению жирных кислот в печени.Сообщается, что анаболические стероиды обладают множеством метаболических действий. 14 Некоторые из них могут воздействовать на факторы, регулирующие окисление жирных кислот. Последний в значительной степени регулируется потоком ацильных групп в митохондрии. Основным фактором, влияющим на поток ацилов, является их доступность, как обсуждалось ранее, но известно, что на окисление жирных кислот влияют и другие факторы. Они включают концентрацию малонил-КоА, активности карнитин-ацилкарнитин-транслоказы I и II, окислительно-восстановительное состояние никотинамидадениндинуклеотида (NAD+/NADH) и активность различных ядерных рецепторов (например, рецептора, активируемого пролифератором пероксисом-α) и гормонов. адреналин, гормоны щитовидной железы, инсулин и глюкагон), среди прочего. 15-17 Таким образом, возможно, что анаболические стероиды могут напрямую влиять на скорость окисления жирных кислот, независимо от доступности ацильных групп, образующихся в результате повышенного поступления нежирных кислот в печень. Таким образом, результаты текущего исследования должны открыть новые возможности для понимания регуляции окисления жирных кислот.

Таким образом, краткосрочное лечение оксандролоном приводит к заметному печеночному кетогенезу во время голодания и во время оральной жировой нагрузки у взрослых мужчин.Поскольку известно, что анаболические стероиды повышают активность HL, что может усиливать приток жирных кислот в печень, нас побудили задаться вопросом, может ли быть связано с терапией оксандролоном усиление кетогенеза. На самом деле это наблюдалось, что согласуется с нашей гипотезой. Тем не менее, помимо основных наблюдений, фактический механизм усиления кетогенеза анаболическими стероидами должен ждать более подробных исследований in vitro и in vivo на различных животных. Для будущих исследований мы предлагаем рассмотреть возможность того, что активность HL является более сильным регулятором притока жирных кислот в печень, чем считалось ранее.

БЛАГОДАРНОСТЬ

Авторы благодарят Лауру Колдуэлл, PAC, Риту Немонс, Р.

Добавить комментарий

Ваш адрес email не будет опубликован.