Метан для мышц побочные эффекты: Метандиенон — описание вещества, фармакология, применение, противопоказания, формула

Содержание

Метан для мышц:СТЕРОИДЫ

Эта статья будет полезна к изучению как натуральным бодибилдерам, так и людям, использующим для ускорения роста мышц синтетические препараты, так называемым «химикам». Сегодня мы рассмотрим такой распространенный и всеми обсуждаемый сленговый термин, как «метан» — для одних это запретный плод, а для других это до боли родное и знакомое слово. Но ни те, ни другие, зачастую, не знают и не задумываются о его пользе и вреде, дозировках и ограничениях, режимах приема и фармакологических механизмах воздействия на организм атлета…

Неконтролируемое применение метана простыми обывателями из тренажерного зала.

Употребление метана окутано множеством стереотипов. Самый распространенный из них: «как все, так и я». При этом большинство пользователей этого препарата даже не знают правильного его названия – «метандростенолон». А его употребление ограничивают первым попавшимся из множества существующих режимом приема, хотя этому аспекту не мешало бы уделить больше времени,  раз уж Вы решили подсесть на прием анаболических стероидов. Как уже упоминалось нами выше, разработано несколько различных режимов употребления метана, но все они могут нанести непоправимый вред здоровью, если детально не разобраться и не вникнуть во все тонкости этого продукта. Помните, что ответственность за состояние своего организма и здоровья в целом лежит исключительно на Ваших плечах, и никто иной не примет за Вас решение о приеме «метана» и выборе употребляемых доз. Мы не единственные, кто затрагивает эту интереснейшую тему, так как написано о ней уже очень много. Постараемся же подробно и понятно объяснить некоторые детали для понимания необходимости ставить подобные эксперименты над собственным организмом.

Метан для мышц и его биография

Метан  в виде таблеток появился в пятидесятых годах двадцатого века, когда и ещё и тренажеров толком-то и не было. А до этого таблетированного момента его употребление сводилось к использованию инъекций. Однако инъекционный подход имел два существенных недостатка: короткий срок действия вещества и отнюдь неудобная форма применения препарата. Первый недостаток приводил к необходимости огромного числа инъекций в течение дня, а для этого требовалась подготовка, и это занимало много времени. Второе неудобство обеспечивало человеку постоянные неприятные болевые ощущения, образование рубцов, проблемы рассасывания и т.д.  Именно эта причина приносила наибольшие затруднения в применении метана, так как первыми пациентами, которым прописывался этот препарат, были преимущественно люди, перенесшие серьезнейшие операции или ранения, имели тяжелые формы инфекционных заболеваний, в общем итак получали огромную дозу различного рода уколов. В виду всех вышеизложенных доводов, создание орального вида стероида пришлось как нельзя кстати.

Однако помимо этого, отрицательным аспектом большинства практикующихся в то время видов анаболических стероидов являлся и их высокий уровень эндрогенности, т.е. гормональные изменения человеческого организма, способствующие более интенсивной выработке мужских половых признаков.   Наряду со всеми этими недостатками, существовал еще и огромный перечень побочных эффектов. Так, например, распространенный в тот период препарат: метилтестостерон мог вызвать в человеческом организме такое заболевание как желтуха. Ряд этих крупных проблем, а также множество мелких сопутствующих минусов послужили толчком к созданию метандростенолона.

Во второй половине двадцатого века благодаря издательству «Спорт» выходит книга под названием «Анаболические стероиды». Из нее мы узнаем новое название метандростенолона – дианабол. Это уже оральный препарат, разработанный одним из американских ученых —  Дж.Циглером аж в 1956 году благодаря поддержке компании «Ciba-Geigy». С течением времени названия метана менялись, так же как и фирмы производители. Неизменным оставалось только действующее вещество – метандиенон или метандростенолон. Из-за множества фармацевтических компаний оральные стероиды могли различаться по «чистоте» метандростенолона. И, также как и в наши дни, среди препаратов встречаются откровенный брак и подделки, содержащие в таблетке несоответствующее этикетке количество действующего вещества.

Тем не менее, считается, что на этом этапе развития и становления препарата, многие имеющиеся ранее проблемы были решены. И самый главный плюс, прежде всего, — это таблетированная форма выпуска препарата. К тому же она имела свойство не разрушаться внутри желудка атлета, а всасываться прямо в кровь. Это свойство таблетка имела из-за присутствия в содержании метиловой группы. Фактически, Метандростенолон – это, по сути, ни что иное, как метилтестостерон после  дегидрирования. Поэтому можно встретить еще одно его название – дегидрометилтестостерон. Только вот процесс дегидрирования не отменяет, к сожалению, множества побочных эффектов, таких как желтуха, отеки и дисперсии, и даже увеличение печени.  Еще одной решенной проблемой стало снижение уровня эндрогенности. Если в подробностях вдаваться в спортивную фармакологию, то можно сказать, что метандростенолон по своему биологическому воздействию и химическому строению напоминает тестостерон. Конечно, сложно все это описать, но все же: уровень анаболической активности этих двух компонентов (метандростенолона и тестостерона) практический одинаковый, а вот эндрогенное действие, оказываемое тестостероном, в несколько десятков раз превышает показатели метандростенолона. Однако в силу множества причин даже препараты, основанные на тестостероне, имеют популярность среди культуристов…

Любопытным фактом является то, что метандростенолон, кроме своей основной функции, как оральный анаболик, еще и является активным веществом в составе выпускаемой мази наружного применения с одноименным названием. Ее основное назначение – лечение от облысения.

Так почему же метан так популярен в среде культуристов? И что же по этому поводу думают сами «химики»? Попробуем теперь ответить на эти вопросы.

Проведенный нами статистический опрос, показал, что бодибилдеры и прочие любители «железа» и тренажеров, решающие стимулировать рост своей мускулатуры за счет анаболических стероидов, в действительности предпочитают начинать именно с применения метана. Этот выбор основывается на трех основных причинах, которые мы опишем одновременно с их «разоблачением»:

Самой главной причиной выбора данного препарата является так подробно описанная выше таблетированная форма. Да-да, именно форма. Ведь простота – это зачастую залог успеха. Удобство таблеток просто несравнимо с введением инъекций. А еще вдобавок к этому, многие люди проводят ассоциативный ряд инъекционных препаратов с наркотическими средствами. После чего опасаются возникновения у них зависимости из-за этих уколов. Применение стероидных препаратов – это не столь пагубная привычка, а вот наркотики – это уже дело серьезное и незаконное. А таких проблем никто не хочет приобрести. Так вот, еще раз скажем, это просто ассоциации, основанные на психологических размышлениях, не подкрепленные никакой доказанной базой.  Анаболические стероиды ни в коем разе нельзя назвать наркотическими средствами в прямом смысле этого слова. Безусловно, они принимаются человеком для более результативного и быстрого достижения поставленной задачи и этот эффект естественно вызывает чувство удовлетворенности собой и радость. И, кажется, что без этого уже нет смысла в тренировках. Но, все-таки, метан — не наркотическое вещество, так как оно не влияет на работу центральной нервной системы организма, в последствии чего  возникает имитация воздействия эндорфинов, повышающих настроение, или наоборот снижение болевого порога и так прочие эффекты. Стероиды по-другому воздействуют на организм. Это гормональные изменения. А все перечисленные выше психологические всплески – это просто эмоции. Так что применение таблеток или инъекций – это выбор каждого отдельного человека. Надо только запомнить, что и то и другое имеет и приводит фактически к одному и тому же результату. Ведь отличие между ними лишь в способе приема и ввода в организм, а никак не в составе, и не в способе воздействия.

Вторым аспектом, заставляющим выбирать именно метан для роста мышц, является его относительно небольшая стоимость. Хотя и в этой причине есть к чему придраться. Конечно, сам препарат достаточно просто купить любому человеку. Его стоимость (месячный курс) варьируется от 6 до 12 долларов США. Однако не стоит забывать про дальнейшие последствия. Ведь после приема метана обязателен курс реабилитационной терапии. Не стоит об этом забывать. После приема анаболика необходимо позаботиться о печени, на что уйдет порядка 30-40 долларов США. А для удержания набранной мышечной массы придется потратиться дополнительно на препараты калия и кальция. Данными восстановительными мероприятиями ни в коем разе не стоит пренебрегать, иначе дальнейшие занятия могут быть уже лишними… Вот и считайте – так сказать, двойная математика.

Третьей причиной приема метана является его распространенность. Информация негласно распространяется в качалках, спортклубах, тренажерных залах, фитнес секциях, и передается по цепочке – эффект так называемого «Сарафанного радио». Кто-то попробовал – тут же посоветовал другому, умудренные опытом бодибилдеры  рекомендуют его новичкам и так далее. Но, данный вариант для зелёного новичка, впервые увидевшего тренажер, не только не хорош и прост, — а вовсе неправильный и даже опасный! А ведь все эти проблемы сводятся к банальному недостатку информации по данному вопросу, некой закрытости этой темы. Грамотно растолкованные понятия и достоверно предоставленные сведения о воздействии метана на организм всерьез просветили бы всех новичков-химиков по данному вопросу. Тем сам, помогая им избежать огромного числа стандартного ряда типовых ошибок.

Что ж, рассмотрим все детали и нюансы употребления метана. Но, в первую очередь хочется добавить мнение о современной возможности химического наращивания мышечной массы каким-либо иным способом, нежели употребление такого морально устаревшего препарата как метандростенолон.  Человечество не стоит на месте, а постоянно развивается, точно также как и фармакология. Стоит воздержаться от употребления этого анаболического стероида хотя бы из-за древности его происхождения. Ведь история его создания уже перешагнула полувековой рубеж.  Достижения в области фармакологии значительно шагнули вперед. Поэтому употребление таблетированных стероидных препаратов типа анаполона, примоболана, станазолола, метилтестостерона, галотестина и метана просто неоправданный и необдуманный поступок. Если применение этих препаратов вызовет у Вас серьезные осложнения со здоровьем, как например испорченная печень или желудок, никакая  накаченная мышечная масса не заменит Вам его и не компенсирует затраты на восстановление органов жизнедеятельности… В случае, если же Ваше желание «химичить» — твёрдо и непоколебимо, остановите свой выбор, например, на андриоле, — степень риска, при его использовании, в разы ниже.

Как правильно применять метан для мышц 

Если же все наши доводы на Вас не повлияли, и потребность применить на себе такой препарат как метан все же не исчезла, то просто жизненно необходимо знать несколько простых правил его грамотного использования. Итак, первое из них: Дозировки при приеме не должны носить принцип пирамиды, т.е периодическое увеличение дозировки с течением времени. Данный режим не является эффективным. В течение первого времени приема естественно Вы увидите и ощутите результаты. Однако в последствии такой прием просто вызовет привыкание организма к данному стероиду, и результативность действий просто окажется под угрозой. Это можно сравнить со способом привыкания к яду, использовавшимся в древние далекие времена. А в случае с метанов все, чего Вы добьетесь, это головные боли и излишки накопленной жидкости в организме. В тоге Вы просто вынуждены будите от него отказаться, понапрасну потеряв силы и средства, рисковав своим здоровьем, и не добившись желаемого результата.

метан для мышц побочные эффекты_Metan dla mishc i pobochnie effekti Наши многолетние исследования показали, что дозы принимаемого метана должны быть постоянными по величине, а режим приема обусловлен биологическим ритмом организма. Поэтому временные рамки приема составляют: в утреннее время с 6 до 9 часов, в вечерние часы — с 17 до 21. Это обусловлено наибольшим содержанием в мужской крови гормона тестостерона. Ну а если Вы сталкиваетесь с проблемой непостоянного распорядка дня, вызванного например, посменной работой, то Вам просто необходима консультация специалистов и совместная с ними разработка правильного индивидуального режима применения метана.

Как уже упоминалось ранее, метан оказывает воздействие на гормональный фон человека. Отсюда и привязка к биологическому ритму. Это дает возможность усиленного действия употребляемого препарата в совокупности с гормональными возможностями организма. Двухразовый прием анаболического средства может вначале быть не столь результативным, как более распространенный метод приема по 3 или 4 раза в день. Однако двухразовая схема является более естественной. А учащенное применение может вызвать описанное выше привыкание к препарату. Смысл продолжать прием будет потерян буквально через неделю.

Первый курс метана и его правильная дозировка

При вопросе о дозировках никогда не стоит забывать индивидуальные особенности организма. А в целом наиболее оптимальной дозой будет 4-5 таблеток, что составляет 20-25 миллиграммов препарата. Курс приема должен длиться не больше месяца, оптимально это три-четыре недели. За данный период Ваш организм не успеет привыкнуть, и результативность будет на максимальном уровне, тогда как побочные действия будут еще не столь ощутимы. После курса анаболических стероидов просто необходимо делать перерыв и позаботиться о реабилитации печени.

При начале приема, а правильнее сказать, при принятии решения о начале приема, просто жизненно необходимо досконально изучить всю информацию о данном препарате. Уже не раз упомянутое тривиальное незнание и нехватка сведений порождают множество мифов приема метана. Причем не все из них незначительные, и могут существенно навредить здоровью.

Метан для мышц побочные эффекты и распространенные мифы о метане:

Во-первых, метан не следует глотать, его надо рассасывать. Те, кто думает, что при разжевывании или рассасывании он попадает в кровь через сосуды, расположенные в полости рта и тем самым не наносит вред печени, просто заблуждаются. Так как печень – это человеческий фильтр, через который кровь пройдет в любом случае. А оптимальность такого приема просто вызвана тем, что в данном случае концентрация препарата будет больше. При попадании таблетки в желудок, часть вещества просто разрушается из-за  воздействия желудочного сока. А вот при рассасывании таблетки как раз таки наша кровь обогащается желаемым веществом.  А вот вред для печени, к сожалению, одинаковый – хочешь — глотай, а хочешь — рассасывай.

Бытует мнение, что метан необходимо растворять в небольшом количестве растительного масла и так употреблять. Мол, тогда в кровь препарат попадет не из желудка, а из кишечника. Однако аргумент все тот же. Вся кровь проходит через печень и последствий этого никак не избежать. Правда, растительное масло способно в некоторой степени препятствовать разъеданию желудочными соками компонентов анаболического вещества. Вот, пожалуй, единственный аргумент в пользу данного способа приема.

Еще одним мифом, бытующим при приеме препарата, является его время приема до и после еды. Многие атлеты-химики считают, что нужно употреблять таблетки перед едой, а вот если возникают какие-то боли в животе, то нужно употреблять препарат вместе с едой одновременно. Внимание! Это – полнейший бред и заблуждение! В случае если  прием стероида приводит к болевым ощущениям, его срочнейшим образом необходимо полностью исключить! Болевая реакция – это сигнал организма о возможных негативных последствиях. А прием метана одновременно с едой просто оттягивает момент его всасывания в кровь.

Главные выводы

Подведем итоги. Если желание принимать метандростенолон велико и непоколебимо, в первую очередь досконально и полно изучите всю необходимую информацию. Не ограничивайтесь рассказами ребят из качалки. Избегайте приема препарата по принципу пирамиды, он вызовет привыкание и отсутствие результата, а лишь наличие побочных явлений. Оптимальный прием: два раза в сутки утром и вечером по 20-25 миллиграммов в связке с достаточным белковым питанием и качественной работой с «железом» и на тренажерах.  Курс приема не должен превышать трех-четырех недель. После этого просто необходим курс по восстановлению работы печени.

И последнее: Важно понимать, что данная статья ни в коей мере не является призывом к использованию анаболических препаратов. Мы привели лишь некоторые рекомендации по приему метана, так сказать, в чисто информативных целях, всего-навсего для ознакомления. А тот, кто планирует практически воспользоваться этой информацией, должен знать, что весь риск и всю ответственность за вероятные последствия он возлагает лишь лично на себя самого.

Читайте ещё:

кето питание как быстро войти в кетоз

Ключевые слова: что можно на кето диете список, где купить кето питание как быстро войти в кетоз, где можно купить keto eat fit.


препарат кето диета цена, кето рафаэлло, диета хамдий кетогенная, кето креветки, доктор берг кето диета на русском

Описание

Не согласна с отрицательными отзывами, я довольна действием этого препарата. Он хорошо ускоряет метаболизм, поэтому килограммы уходят очень быстро. С побочными явлениями ни разу не столкнулась. Шафрановое масло – стимулирует обменные процессы. За счет содержания омега-6 жирных кислот снижает уровень холестерина. Выводит шлаки и не дает излишкам жира откладываться в резерв. Дополнительно снижает уровень сахара в крови, улучшает состояние ногтей и волос.


Официальный сайт кето питание как быстро войти в кетоз

Состав

Исследования показали, что диеты, которые способствуют кетозу, очень полезны. Вот 7 эффективных советов, как попасть в кетоз. Как и многие другие аспекты питания, достижение и поддержание состояния кетоза очень индивидуализированы. Следовательно, может быть полезно проверить уровень. Кето-диета помогает многим людям, потому что она нацелена на несколько ключевых, основных причин увеличения веса, включая гормональный дисбаланс, резистентность к инсулину в сочетании с высоким уровнем сахара в крови, тяга к поглощению углеводов и ненужных калорий, с которыми борется. Как быстро войти в состояние кетоза. Польза, противопоказания для женщин. Кето-диета или кетогенная диета — это образ питания, который включает в себя употребление пищи с низким содержанием углеводов и высоким содержанием жиров, в результате которой происходит более быстрое снижение массы тела. Кетоз — это метаболическое состояние, абсолютно нормальное для человеческого организма. Оно приводит к серьезному ограничению подачи углеводов, и в результате ваше тело переключается на сжигание жира вместо глюкозы. И лайфахаком, как быстро войти в кетоз. На кетодиете основным источником энергии становятся кетоны из жиров, а организм находится в метаболическом состоянии кетоз. Благодаря этому на кето легко худеть: организму. Здоровый образ жизни Здоровье и красота Кето питание как быстро войти в Кетоз. Тем не менее, люди также входят в кетоз, если они уменьшают потребление углеводов соответственно до уровня ниже 50 г в день. Как войти в состояние кетоза. Чтобы войти в кетоз и начать худеть. Кето-диета основана на поступлении ограниченного количества углеводов. Сгорая, глюкоза быстро выведет вас из состояния кетоза, и снабдит быстрой энергией для тренинга. Эта методика также позволит мгновенно вывести глюкозу из крови. Сколько жирной еды можно есть на кето-диете? Кето-диета – жировой поединок во имя стройности. Запускается кетоз – естественный процесс внутри тела, который обычно вступает в дело при сильном голоде. Кето питание действительно очень отличается от того, к чему вы привыкли на стандартных диетах и системах питания. Правда я уже тогда была в кетозе и вот такие внезапные зажоры были связаны с циклом, либо с какой-то жизненной ситуацией. И такие психологические моменты тоже сказываются на фигуре. Как войти в кетоз. Почему кето диета безопасна?. Кето — это сокращение от кетоза, которое является результатом соблюдения стандартной кетогенной диеты. В популярной литературе о здоровом питании очень мало рассказывается о пользе низкоуглеводных диет, типа кето диеты. Эти диеты не только. Кето диета – это альтернатива полной голодовки, позволяющая наносить меньший ущерб организму. Описанный выше механизм кетоза поможет понять принцип кето диеты. Настоящий минус заключается в несбалансированном питании. Как войти в кето режим? Как похудеть с пользой для здоровья?. Это не обязательный элемент кето диеты. Более Того в нормальном режиме кетогенного питание постоянный приём МСТ не нужен и даже может быть вреден! Что есть на Кето Диете. Как войти в кетоз? Как понять, что ты в Кетозе?. При обычном питании с повышенным содержанием углеводов, организм будет. Кетоз — натуральный процесс, который запускает организм для выживания при. Чтобы воспользоваться преимуществами кето-диеты, ваше тело должно войти в состояние, которое называется кетоз. Это метаболическое состояние, при котором ваш организм превращает жир в молекулы, называемые кетонами, которые он использует в качестве основного источника энергии, когда глюкоза.

Эффект от применения

К средству SlimBiotic отношусь положительно. Один из немногих препаратов, способных устранить жировые отложения без вреда для здоровья. Благоприятно отражается на состоянии эндокринной, пищеварительной, сердечно-сосудистой системы. Не вызывает привыкания, поэтому эффект, которого удалось достичь благодаря приему средства, сохраняется даже после прекращения курса. SlimBiotic – препарат растительного происхождения, созданный с целью устранения причин появления лишнего веса и непосредственной борьбы с жировыми отложениями. Является натуральным природным концентратом полезных веществ, поэтому безопасен для здоровья. Полный курс похудения рассчитан на 1 неделю, в течение которой происходит нормализация внутренних процессов и запускается активный липолиз. Форма выпуска – ампулы с жидким содержимым для приема внутрь.

Мнение специалиста

Потеряла на данном средстве около 4 кг , что меня очень радует. SlimBiotic, действительно хорошо сжигает жировые отложения, а главное без побочных действий. После первых дней приема появились хорошие результаты, думаю за неделю по моим подсчетам сброшу 6 кг, а это уже замечательный эффект.

Меню кето-диеты на неделю с рецептами и точными макросами (КБЖУ). Подходит на каждый день как для женщин, так и для мужчин. Я подготовила детальное меню кетогенной диеты на 7 дней, в основе которого лежат следующие принципы: Простые и быстрые рецепты. Блюда, которые можно легко съесть. Чем кето диета отличается от других диет и особенности рациона. Так как основным топливом для питания мозга. 10 граммов углеводов на каждый килограмм веса тела будет достаточно. Когда? Спустя двух и более недель кето-диеты. Длиться загрузка должна не более 12–18 часов. Кетодиета — это высокожировой низкоуглеводный рацион, самая строгая разновидность LCHF-рациона (low carb high fat). На кетодиете количество углеводов ограничено 20-25 г в сутки. Это, например, 1 яблоко. Но яблоки на кето не едят, как и крупы, хлеб, пасту, картошку, сахар, мед, фрукты. Источники. Кето диета: меню на неделю для женщин. Владимир Кетонов 21.06.2019. если вы жить не можете без сладкого вам на помощь придут товары из магазинов спортивного питания: безуглеводные протеиновые батончики, сиропы на основе. Кетоновая версия и примерное питание для женщин. Что такое кето и кетодиета — способы. Кетозная программа похудения – это питание с низким содержанием углеводов. Для тех, кого интересует правильное питание. Меню на каждый день. Свежие публикации. Спирулина и ее лекарственные свойства. Меню для кетогенной диеты для похудения с уже рассчитанным БЖУ для. Ниже вы найдёте 21 рецепт — завтрак, обед и ужин каждый день в течение недели. Кето-меню 1-ая неделя. В этом меню собраны простые в приготовлении блюда, для которых вам потребуется не более 5 ингредиентов. Кето диета позволяет достичь очень хороших результатов при похудении, и в то же время прекрасно работает в качестве профилактики многих заболеваний. Мы предлагаем вам план кето меню на 2 недели, если вам не хочется придумывать, что готовить, или вы е. Диета кето: меню на неделю с рецептами. Виктория Высоцкая специально для Glamusha.Ru. Следуя данной системе питания, вы должны понять одну важную вещь — не существует одного меню для худеющих, так как каждый рацион подбирается исходя из индивидуальных потребностей человека, его веса. — Кето диета — довольно экстремальный вид диеты. Отказ от углеводов грозит срывами на неправильное питание, головными болями, слабостью, ознобом. При резком переходе на кето диету может возникнуть обострение панкреатита и другие проблемы со здоровьем. Обязательна консультация врача, — советует. Кетогенная кето-диета – это низкоуглеводная диета, при которой характерно высокое содержание в рационе жиров и умеренное количество белков. За счет низкого содержания в суточном меню углеводов.

Назначение

SlimBiotic – препарат растительного происхождения, созданный с целью устранения причин появления лишнего веса и непосредственной борьбы с жировыми отложениями. Является натуральным природным концентратом полезных веществ, поэтому безопасен для здоровья. Полный курс похудения рассчитан на 1 неделю, в течение которой происходит нормализация внутренних процессов и запускается активный липолиз. Форма выпуска – ампулы с жидким содержимым для приема внутрь.

Как заказать?

Заполните форму для консультации и заказа кето питание как быстро войти в кетоз. Оператор уточнит у вас все детали и мы отправим ваш заказ. Через 1-10 дней вы получите посылку и оплатите её при получении.

кето питание как быстро войти в кетоз. keto enol tautomerism. Отзывы, инструкция по применению, состав и свойства.

Метан — его польза, погубное воздействие, правило приема и мифы. Метан, являясь стероидом,способен оказывать пагубное влияние на организм человека, которого можно избежать, если подробней ознакомиться с некоторыми особенностями применения препарата. Все те, кто наращивают мышечную. Принимать или не принимать метан – вот в чем вопрос Для химиков (то есть, людей, которые используют синтетические препараты с целью ускоренного наращивания. Метан имеет очень быстрый период полураспада в организме – максимум пару часов, именно по этой причине употреблять этот анаболик рекомендуется несколько раз в день для достижения оптимальной концентрации действующего вещества в течение всего дня. Применение, комбинирование и краткая. Метан соло на 1 курс это ок,откуда вы свои бредо копипасты берете. ЗЫ.Все что я написал естественно с учетом что действительно что не соревнующимся атлетам лучший курс АА,это никакой.Это факт.А те кому это надо сами все знают на 3-4-5+ Год занятий в тренажерке. раскрыть ветку 1. +2. timurbotan. 3 года. Употребление препаратов способствующих наращиванию мышечной массы в среде людей занимающихся бодибилдингом считается нормой. Одни из них можно без вреда принимать в любом количестве, употребление других – строго ограничено. Метан для мышц используют Худеем — цель! Метан при похудении. Метан при похудении. 18.04.2019 admin Комментарии Нет комментариев. В правильных дозировках вред для здоровья минимальный и его можно не учитывать. Метандиенон (метан) — эффективный стероид для мышц. Доставка курьером и почтой. Быстро и надежно. Особую популярность средство приобрело в бодибилдинге и тяжелой атлетике. Купить метан для мышц в Москве также можно под другими торговыми названиями: Дианобол, Неробол, Наносим. Метан для мышц используется в бодибилдинге и других силовых видах спорта, где нужна мышечная масса. Анаболики принимают соло или в составе стероидных курсов. Побочные эффекты, правила применения метана для мышц. Метандростенолон, или метан, является одним из анаболических стероидов. Вначале он предназначался для ускоренного восстановления и лечения ожогов.


Официальный сайт кето питание как быстро войти в кетоз

✔ Купить-кето питание как быстро войти в кетоз можно в таких странах как:


Россия, Беларусь, Казахстан, Киргизия, Молдова, Узбекистан, Украина Армения


Шафрановое масло – стимулирует обменные процессы. За счет содержания омега-6 жирных кислот снижает уровень холестерина. Выводит шлаки и не дает излишкам жира откладываться в резерв. Дополнительно снижает уровень сахара в крови, улучшает состояние ногтей и волос. Метан — его польза, погубное воздействие, правило приема и мифы. Метан, являясь стероидом,способен оказывать пагубное влияние на организм человека, которого можно избежать, если подробней ознакомиться с некоторыми особенностями применения препарата. Все те, кто наращивают мышечную. Принимать или не принимать метан – вот в чем вопрос Для химиков (то есть, людей, которые используют синтетические препараты с целью ускоренного наращивания. Метан имеет очень быстрый период полураспада в организме – максимум пару часов, именно по этой причине употреблять этот анаболик рекомендуется несколько раз в день для достижения оптимальной концентрации действующего вещества в течение всего дня. Применение, комбинирование и краткая. Метан соло на 1 курс это ок,откуда вы свои бредо копипасты берете. ЗЫ.Все что я написал естественно с учетом что действительно что не соревнующимся атлетам лучший курс АА,это никакой.Это факт.А те кому это надо сами все знают на 3-4-5+ Год занятий в тренажерке. раскрыть ветку 1. +2. timurbotan. 3 года. Употребление препаратов способствующих наращиванию мышечной массы в среде людей занимающихся бодибилдингом считается нормой. Одни из них можно без вреда принимать в любом количестве, употребление других – строго ограничено. Метан для мышц используют Худеем — цель! Метан при похудении. Метан при похудении. 18.04.2019 admin Комментарии Нет комментариев. В правильных дозировках вред для здоровья минимальный и его можно не учитывать. Метандиенон (метан) — эффективный стероид для мышц. Доставка курьером и почтой. Быстро и надежно. Особую популярность средство приобрело в бодибилдинге и тяжелой атлетике. Купить метан для мышц в Москве также можно под другими торговыми названиями: Дианобол, Неробол, Наносим. Метан для мышц используется в бодибилдинге и других силовых видах спорта, где нужна мышечная масса. Анаболики принимают соло или в составе стероидных курсов. Побочные эффекты, правила применения метана для мышц. Метандростенолон, или метан, является одним из анаболических стероидов. Вначале он предназначался для ускоренного восстановления и лечения ожогов. К средству SlimBiotic отношусь положительно. Один из немногих препаратов, способных устранить жировые отложения без вреда для здоровья. Благоприятно отражается на состоянии эндокринной, пищеварительной, сердечно-сосудистой системы. Не вызывает привыкания, поэтому эффект, которого удалось достичь благодаря приему средства, сохраняется даже после прекращения курса.

Не согласна с отрицательными отзывами, я довольна действием этого препарата. Он хорошо ускоряет метаболизм, поэтому килограммы уходят очень быстро. С побочными явлениями ни разу не столкнулась.

Экстракт померанца – содержит синефрин. Это вещество повышает энергетические затраты организма, стимулируя активный синтез энергии из жира. Параллельно усиливает термогенез, что тоже важно для эффективной борьбы с лишними кг. Померанец также повышает выносливость, активность, борется с аппетитом и предотвращает преобразование питательных веществ в жировые запасы.

Препарат доставляется по всей России и СНГ. Товар оплачивается только при получении. Как правило, цена на SlimBiotic в аптеках значительно выше, нежели в интернете. Проконсультироваться и получить более детальную информацию о товаре можно указав контакты на официальном сайте, оператор перезвонит в течении нескольких минут.

Таблетки Метан для мышц | Побочные эффекты | Первый курс метана

В этой статье мы будем называть вещи своими именами. Она будет полезна к прочтению как натуральным бодибилдерам, так и людям, использующим для ускорения роста мышц синтетические препараты, так называемым «химикам». Сегодня мы рассмотрим такой распространенный и всеми обсуждаемый сленговый термин, как «метан» — для одних это запретный плод, а для других это до боли родное и знакомое слово. Но ни те, ни другие, зачастую, не знают и не задумываются о его пользе и вреде, дозировках и ограничениях, режимах приема и фармакологических механизмах воздействия на организм атлета…

Ищешь таблетки метан для мышц? — тебе сюда! Почему? Помимо исчерпывающей информации у нас более 450 комментариев с горячим обсуждением: Как принимать? С чем? Какие побочки? Есть ли противопоказания? Оптимальная дозировка? Сочетание с другими препаратами ? и тд – здесь ты найдешь ответы на любые вопросы о метандростенолоне … Но, сперва, немного предыстории…

Наплевательское применение метана простыми обывателями из тренажерного зала.

Употребление метана окутано множеством стереотипов. Самый распространенный из них: «как все, так и я». При этом большинство пользователей этого препарата даже не знают правильного его названия – «метандростенолон». А его употребление ограничивают первым попавшимся из множества существующих режимом приема, хотя этому аспекту не мешало бы уделить больше времени,  раз уж Вы решили подсесть на прием анаболических стероидов. Как уже упоминалось нами выше, разработано несколько различных режимов употребления метана, но все они могут нанести непоправимый вред здоровью, если детально не разобраться и не вникнуть во все тонкости этого продукта. Помните, что ответственность за состояние своего организма и здоровья в целом лежит исключительно на Ваших плечах, и никто иной не примет за Вас решение о приеме «метана» и выборе употребляемых доз. Мы не единственные, кто затрагивает эту интереснейшую тему, так как написано о ней уже очень много. Постараемся же подробно и понятно объяснить некоторые детали для понимания необходимости ставить подобные эксперименты над собственным организмом.

По факту метан – самый распространенный нынче стероид во всём Мире. Практически все маститые атлеты и билдеры со стажем посоветуют в качестве начального курса задействовать именно метан. Помимо этого, по сравнению с другими анаболиками, метандростенолон – наиболее бюджетный вариант. Совсем недорого и эффективно! 

Таблетки метан. История появления.

Метан  в виде таблеток появился в пятидесятых годах двадцатого века, когда и ещё и тренажеров толком-то и не было. А до этого таблетированного момента его употребление сводилось к использованию инъекций. Однако инъекционный подход имел два существенных недостатка: короткий срок действия вещества и отнюдь неудобная форма применения препарата. Первый недостаток приводил к необходимости огромного числа инъекций в течение дня, а для этого требовалась подготовка, и это занимало много времени. Второе неудобство обеспечивало человеку постоянные неприятные болевые ощущения, образование рубцов, проблемы рассасывания и т.д.  Именно эта причина приносила наибольшие затруднения в применении метана, так как первыми пациентами, которым прописывался этот препарат, были преимущественно люди, перенесшие серьезнейшие операции или ранения, имели тяжелые формы инфекционных заболеваний, в общем итак получали огромную дозу различного рода уколов. В виду всех вышеизложенных доводов, создание орального вида стероида пришлось как нельзя кстати.

Однако помимо этого, отрицательным аспектом большинства практикующихся в то время видов анаболических стероидов являлся и их высокий уровень эндрогенности, т.е. гормональные изменения человеческого организма, способствующие более интенсивной выработке мужских половых признаков.   Наряду со всеми этими недостатками, существовал еще и огромный перечень побочных эффектов. Так, например, распространенный в тот период препарат: метилтестостерон мог вызвать в человеческом организме такое заболевание как желтуха. Ряд этих крупных проблем, а также множество мелких сопутствующих минусов послужили толчком к созданию метандростенолона.

Во второй половине двадцатого века благодаря издательству «Спорт» выходит книга под названием «Анаболические стероиды». Из нее мы узнаем новое название метандростенолона – дианабол. Это уже оральный препарат, разработанный одним из американских ученых —  Дж.Циглером аж в 1956 году благодаря поддержке компании «Ciba-Geigy». С течением времени названия метана менялись, так же как и фирмы производители. Неизменным оставалось только действующее вещество – метандиенон или метандростенолон. Из-за множества фармацевтических компаний оральные стероиды могли различаться по «чистоте» метандростенолона. И, также как и в наши дни, среди препаратов встречаются откровенный брак и подделки, содержащие в таблетке несоответствующее этикетке количество действующего вещества.

Тем не менее, считается, что на этом этапе развития и становления препарата, многие имеющиеся ранее проблемы были решены. И самый главный плюс, прежде всего, — это таблетированная форма выпуска препарата. К тому же она имела свойство не разрушаться внутри желудка атлета, а всасываться прямо в кровь. Это свойство таблетка имела из-за присутствия в содержании метиловой группы. Фактически, Метандростенолон – это, по сути, ни что иное, как метилтестостерон после  дегидрирования. Поэтому можно встретить еще одно его название – дегидрометилтестостерон. Только вот процесс дегидрирования не отменяет, к сожалению, множества побочных эффектов, таких как желтуха, отеки и дисперсии, и даже увеличение печени.  Еще одной решенной проблемой стало снижение уровня эндрогенности. Если в подробностях вдаваться в спортивную фармакологию, то можно сказать, что метандростенолонпо своему биологическому воздействию и химическому строению напоминает тестостерон. Конечно, сложно все это описать, но все же: уровень анаболической активности этих двух компонентов (метандростенолона и тестостерона) практический одинаковый, а вот эндрогенное действие, оказываемое тестостероном, в несколько десятков раз превышает показатели метандростенолона. Однако в силу множества причин даже препараты, основанные на тестостероне, имеют популярность среди культуристов…

Любопытным фактом является то, что метандростенолон, кроме своей основной функции, как оральный анаболик, еще и является активным веществом в составе выпускаемой мази наружного применения с одноименным названием. Ее основное назначение – лечение от облысения.

Так почему же метан так популярен в среде культуристов? И что же по этому поводу думают сами «химики»? Попробуем теперь ответить на эти вопросы.

Проведенный нами статистический опрос, показал, что бодибилдеры и прочие любители «железа» и тренажеров, решающие стимулировать рост своей мускулатуры за счет анаболических стероидов, в действительности предпочитают начинать именно с применения метана. Этот выбор основывается на трех основных причинах, которые мы опишем одновременно с их «разоблачением»:

  • Самой главной причиной выбора данного препарата является так подробно описанная выше таблетированная форма. Да-да, именно форма. Ведь простота – это зачастую залог успеха. Удобство таблеток просто несравнимо с введением инъекций. А еще вдобавок к этому, многие люди проводят ассоциативный ряд инъекционных препаратов с наркотическими средствами. После чего опасаются возникновения у них зависимости из-за этих уколов. Применение стероидных препаратов – это не столь пагубная привычка, а вот наркотики – это уже дело серьезное и незаконное. А таких проблем никто не хочет приобрести. Так вот, еще раз скажем, это просто ассоциации, основанные на психологических размышлениях, не подкрепленные никакой доказанной базой.  Анаболические стероиды ни в коем разе нельзя назвать наркотическими средствами в прямом смысле этого слова. Безусловно, они принимаются человеком для более результативного и быстрого достижения поставленной задачи и этот эффект естественно вызывает чувство удовлетворенности собой и радость. И, кажется, что без этого уже нет смысла в тренировках. Но, все-таки, метан — не наркотическое вещество, так как оно не влияет на работу центральной нервной системы организма, в последствии чего  возникает имитация воздействия эндорфинов, повышающих настроение, или наоборот снижение болевого порога и так прочие эффекты. Стероиды по-другому воздействуют на организм. Это гормональные изменения. А все перечисленные выше психологические всплески – это просто эмоции. Так что применение таблеток или инъекций – это выбор каждого отдельного человека. Надо только запомнить, что и то и другое имеет и приводит фактически к одному и тому же результату. Ведь отличие между ними лишь в способе приема и ввода в организм, а никак не в составе, и не в способе воздействия.
  • Вторым аспектом, заставляющим выбирать именно метан, является его относительно небольшая стоимость. Хотя и в этой причине есть к чему придраться. Конечно, сам препарат достаточно просто купить любому человеку. Его стоимость (месячный курс) варьируется от 6 до 12 долларов США. Однако не стоит забывать про дальнейшие последствия. Ведь после приема метана обязателен курс реабилитационной терапии. Не стоит об этом забывать. После приема анаболика необходимо позаботиться о печени, на что уйдет порядка 30-40 долларов США. А для удержания набранной мышечной массы придется потратиться дополнительно на препараты калия и кальция. Данными восстановительными мероприятиями ни в коем разе не стоит пренебрегать, иначе дальнейшие занятия могут быть уже лишними… Вот и считайте – так сказать, двойная математика.
  • Третьей причиной приема метана является его распространенность. Информация негласно распространяется в качалках, спортклубах, тренажерных залах, фитнес секциях, и передается по цепочке – эффект так называемого «Сарафанного радио». Кто-то попробовал – тут же посоветовал другому, умудренные опытом бодибилдеры  рекомендуют его новичкам и так далее. Но, данный вариант для зелёного новичка, впервые увидевшего тренажер, не только не хорош и прост, — а вовсе неправильный и даже опасный! А ведь все эти проблемы сводятся к банальному недостатку информации по данному вопросу, некой закрытости этой темы. Грамотно растолкованные понятия и достоверно предоставленные сведения о воздействии метана на организм всерьез просветили бы всех новичков-химиков по данному вопросу. Тем сам, помогая им избежать огромного числа стандартного ряда типовых ошибок.

Обезопась себя!

Самое первое, что требуется сделать еще до приема курса этого препарата — это сдать анализы и пообщаться с Вашим врачом. Это крайне важно, потому что до курса и после него требуется сравнивать Ваши показатели, и в случае серьезных отклонений придётся пить определенные препараты, которые нормализуют состояние Вашего организма. Мы категорически не рекомендуем употреблять анаболики без предварительной консультации – обязательно нужно чтобы Вас «вёл по этому пути» опытный специалист, с большим багажом знаний в спортивной фармакологии. Также уже изначально  будьте готовы к возможному букету побочных эффектов, которые могут возникать походу использования препарата. Однако не нужно отчаиваться прежде времени, все побочки контролируется средствами после курсовой терапии, о которых мы Вам обязательно далее расскажем… 

Употребление препарата.

Что ж, рассмотрим все детали и нюансы употребления метана. Но, в первую очередь хочется добавить мнение о современной возможности химического наращивания мышечной массы каким-либо иным способом, нежели употребление такого морально устаревшего препарата как метандростенолон.  Человечество не стоит на месте, а постоянно развивается, точно также как и фармакология. Стоит воздержаться от употребления этого анаболического стероида хотя бы из-за древности его происхождения. Ведь история его создания уже перешагнула полувековой рубеж.  Достижения в области фармакологии значительно шагнули вперед. Поэтому употребление таблетированных стероидных препаратов типа анаполона, примоболана, станазолола, метилтестостерона, галотестина и метана просто неоправданный и необдуманный поступок. Если применение этих препаратов вызовет у Вас серьезные осложнения со здоровьем, как например испорченная печень или желудок, никакая  накаченная мышечная масса не заменит Вам его и не компенсирует затраты на восстановление органов жизнедеятельности… В случае, если же Ваше желание «химичить» — твёрдо и непоколебимо, остановите свой выбор, например, на андриоле, — степень риска, при его использовании, в разы ниже.

Применение метана и важные моменты…

Если же все наши доводы на Вас не повлияли, и потребность применить на себе такой препарат как метан все же не исчезла, то просто жизненно необходимо знать несколько простых правил его грамотного использования. Итак, первое из них: Дозировки при приеме не должны носить принцип пирамиды, т.е периодическое увеличение дозировки с течением времени. Данный режим не является эффективным. В течение первого времени приема естественно Вы увидите и ощутите результаты. Однако в последствии такой прием просто вызовет привыкание организма к данному стероиду, и результативность действий просто окажется под угрозой. Это можно сравнить со способом привыкания к яду, использовавшимся в древние далекие времена. А в случае с метанов все, чего Вы добьетесь, это головные боли и излишки накопленной жидкости в организме. В тоге Вы просто вынуждены будите от него отказаться, понапрасну потеряв силы и средства, рисковав своим здоровьем, и не добившись желаемого результата.

Наши многолетние исследования показали, что дозы принимаемого метана должны быть постоянными по величине, а режим приема обусловлен биологическим ритмом организма. Поэтому временные рамки приема составляют: в утреннее время с 6 до 9 часов, в вечерние часы — с 17 до 21. Это обусловлено наибольшим содержанием в мужской крови гормона тестостерона. Ну а если Вы сталкиваетесь с проблемой непостоянного распорядка дня, вызванного например, посменной работой, то Вам просто необходима консультация специалистов и совместная с ними разработка правильного индивидуального режима применения метана.

Как уже упоминалось ранее, метан оказывает воздействие на гормональный фон человека. Отсюда и привязка к биологическому ритму. Это дает возможность усиленного действия употребляемого препарата в совокупности с гормональными возможностями организма. Двухразовый прием анаболического средства может вначале быть не столь результативным, как более распространенный метод приема по 3 или 4 раза в день. Однако двухразовая схема является более естественной. А учащенное применение может вызвать описанное выше привыкание к препарату. Смысл продолжать прием будет потерян буквально через неделю.

Если Вам требуется более внушительный эффект, то лучше сочетать метандростенолон  с другими анаболическими препаратами. Его действие в связке с оральными или инъекционными стероидами придаст максимальный результат. Доказано, что оптимальная продолжительность одного курса метана не должна быть больше 6-8 недель. Дальше его принимать  уже нет особого смысла, ибо организм начинает подстраиваться под искусственно полученный тестостерон, и синтезирует меньше собственного природного…

Первый курс метана и его правильная дозировка

При вопросе о дозировках никогда не стоит забывать индивидуальные особенности организма. А в целом наиболее оптимальной дозой будет 4-5 таблеток, что составляет 20-25 миллиграммов препарата. Курс приема должен длиться не больше месяца, оптимально это три-четыре недели. За данный период Ваш организм не успеет привыкнуть, и результативность будет на максимальном уровне, тогда как побочные действия будут еще не столь ощутимы. После курса анаболических стероидов просто необходимо делать перерыв и позаботиться о реабилитации печени.

При начале приема, а правильнее сказать, при принятии решения о начале приема, просто жизненно необходимо досконально изучить всю информацию о данном препарате. Уже не раз упомянутое тривиальное незнание и нехватка сведений порождают множество мифов приема метана. Причем не все из них незначительные, и могут существенно навредить здоровью.

Метан для мышц побочные эффекты и распространенные мифы о метане:

Начнем с мифов об этом препарате…

Мифы метандростенолона:  
  • Во-первых, метан не следует глотать, его надо рассасывать. Те, кто думает, что при разжевывании или рассасывании он попадает в кровь через сосуды, расположенные в полости рта и тем самым не наносит вред печени, просто заблуждаются. Так как печень – это человеческий фильтр, через который кровь пройдет в любом случае. А оптимальность такого приема просто вызвана тем, что в данном случае концентрация препарата будет больше. При попадании таблетки в желудок, часть вещества просто разрушается из-за  воздействия желудочного сока. А вот при рассасывании таблетки как раз таки наша кровь обогащается желаемым веществом.  А вот вред для печени, к сожалению, одинаковый – хочешь — глотай, а хочешь — рассасывай.
  • Бытует мнение, что метан необходимо растворять в небольшом количестве растительного масла и так употреблять. Мол, тогда в кровь препарат попадет не из желудка, а из кишечника. Однако аргумент все тот же. Вся кровь проходит через печень и последствий этого никак не избежать. Правда, растительное масло способно в некоторой степени препятствовать разъеданию желудочными соками компонентов анаболического вещества. Вот, пожалуй, единственный аргумент в пользу данного способа приема.
  • Еще одним мифом, бытующим при приеме препарата, является его время приема до и после еды. Многие атлеты-химики считают, что нужно употреблять таблетки перед едой, а вот если возникают какие-то боли в животе, то нужно употреблять препарат вместе с едой одновременно. Внимание! Это – полнейший бред и заблуждение! В случае если  прием стероида приводит к болевым ощущениям, его срочнейшим образом необходимо полностью исключить! Болевая реакция – это сигнал организма о возможных негативных последствиях. А прием метана одновременно с едой просто оттягивает момент его всасывания в кровь.
Побочные эффекты:

По причине массового поступления в организм в искусственного тестостерона, постепенно перестает вырабатываться свой природный. Происходит нарушение внутреннего гормонального фона. А  в случае приема в количестве значительно большем рекомендуемой дозы, вы вполне можете попасть на ряд возможных побочек. Наиболее распространенные это: гинекомастия, чрезмерная залитость водой, кожные моменты: прыщи, угри, акне и прочие… Однако все побочные эффекты держутся под контролем при помощи ПКТ – так называемой, после курсовой терапии, подробнее о ней далее…

После курсовая терапия.

После курсовая реабилитация  необходима для минимизации числа возможных побочек, а также очищения печени, и предотвращения сильного отката. Откат, это когда после прекращения приема препарата Вы начинаете терять достигнутые результаты в массе, объеме или силе… Совсем также, как человек, который прекратил заниматься спортом тоже теряет свои прежние показатели, и постепенно у него уменьшается мышечная масса, рельефность и объемы…

Если Вы ощущаете чрезмерную залитость водой, — следовательно  у Вас пошла модификация тестостерона в эстроген. Вам поможет анастрозол, который рекомендуем начать использовать на середине приема курса…

Чтобы не допустить гинекомастию – принимайте тамоксифен, подробнее о нем вот в нашей следующей статье этого раздела..

По окончанию курса рекомендуем кломид или, опять же, тамоксифен – эти  препараты чистят печень, нормализуют гормональный фон.

При грамотном питании и соблюдении всех правил на одном курсе метана можно набрать порядка 6-8кг за 6-8 недель. На наш взгляд, отличный результат! Но требуется постоянно следить за своим состоянием, главное правило: не навреди! При соблюдении всех рекомендаций и под крылом «Матёрого химика» вы вполне сможете добиться внушительных результатов без особого вреда Вашему организму. Ну, а ежели заметили пусть даже незначительные ухудшения – воздержитесь от приема, хотя бы на время, здоровье важнее! Пронаблюдайтесь какое-то время, Вы ведь всегда сможете при желании повторить курс…

Главные выводы

Подведем итоги. Если желание принимать метандростенолон велико и непоколебимо, в первую очередь досконально и полно изучите всю необходимую информацию. Не ограничивайтесь рассказами ребят из качалки. Избегайте приема препарата по принципу пирамиды, он вызовет привыкание и отсутствие результата, а лишь наличие побочных явлений. Оптимальный прием: два раза в сутки утром и вечером по 20-25 миллиграммов в связке с достаточным белковым питанием и качественной работой с «железом» и на тренажерах.  Курс приема не должен превышать трех-четырех недель. После этого просто необходим курс по восстановлению работы печени.

И последнее: Важно понимать, что данная статья ни в коей мере не является призывом к использованию анаболических препаратов. Мы привели лишь некоторые рекомендации по приему метана, так сказать, в чисто информативных целях, всего-навсего для ознакомления. А тот, кто планирует практически воспользоваться этой информацией, должен знать, что весь риск и всю ответственность за вероятные последствия он возлагает лишь лично на себя самого.

Оглавление и Навигация статьи:

Вступление. Что такое метан?

Обывательский взгляд.

Таблетки метан и история.

Метан от облысения.

Причины выбора именно метана.

Современные аналогичные препараты.

Применение метана. Нюансы.

Первый курс метана.

Метан для мышц побочные эффекты.

Заключение и выводы.

  • < Назад
  • Вперёд >

Стероиды | Testosteron.pro

  На одном популярном качковском форуме я прочитал такое сообщение: — Мне 16 лет, хочу накачаться. Тренер советует пару циклов метана, но я хочу усилить и добавить деку. Что посоветуете?

Надо отдать должное читателям форума – пацанчика обозвали молокососом и сказали оправляться обратно в школу, а о метане или деке спрашивать, когда, по крайней мере, лет 25 будет. И еще посоветовали тренера поменять на более ответственного и менее алчного. Сразу отмечу, что форум был посвящен именно стероидам, люди, обитающие там, сами постоянно принимают тот же метан и деку и могут рассказать о них на профессиональном уровне. Поэтому они вполне понимают, что если начинать таким образом уже в подростковом возрасте, то риск побочных эффектов значительно возрастает.

Желание накачаться у парня, конечно, я полностью поддерживаю. Арни начинал примерно в 15-16 и уже в те годы он был очень хорош без всякой химии. Но, друзья мои, если вы задумываетесь о стероидах, то, по крайней мере, выясните о них все, что сможете.

В этой статье мы постараемся в меру наших сил осветить эту тему и выяснить, насколько верен бытующий стереотип, что

стероиды=большие мышцы, и большие мышцы=стероиды.

Я сам никогда не принимал стероиды, и надеюсь обойтись без них в будущем. Поэтому, пишу свою статью на основе не личного, а чужого опыта. А чужого опыта хватает – по мнению авторитетных российских авторов в сфере бодибилдинга, среди профессиональных атлетов число людей, постоянно принимающих стероиды, составляет 99%, и даже среди просто завсегдатаев качалок, занимающихся более 3х лет, это число стремится к таким же цифрам.

Пару лет назад я занимался в полуподвальной качалке и там, для своих, можно было приобрести любую химию без проблем. Позднее, я перешел в модный современный фитнес-клуб, где и занимаюсь постоянно сейчас. Здесь, на вопрос о стероидах тренеры решительно отрицают какую-либо принадлежность к ним или возможность их приобретения. На вопрос – а, почему? – эти же ребята, которые, между прочем, регулярно сами участвуют в соревнованиях, говорят, что это небезопасно, причем по многим причинам.

Это верно. Мне сразу на ум приходит история, случившаяся с тренером из полуподвальной качалки, о которой я упоминал ранее. Он по наивности предложил метан своему приятелю и завсегдатаю своего зала – менту. А тот поступил не как приятель, а как представитель своей славной профессии – посадил тренера за хранение и распространение запрещенных к обороту препаратов. Причем посадил надолго, на пару лет, насколько я помню. Этот печальный пример учит нас двум простым истинам – быть осторожнее со стероидами и любыми запрещенными веществами, и быть осторожнее со всякого рода силовиками, эти товарищи отличаются от простых обывателей по роду своей деятельности.

 

Законодательством Российской Федерации не запрещено употребление сильнодействующих веществ, но ограничено их обращение. Фигня, правда, какая-то получается. Доказать, что таблетки в твоем кармане не для распространения – задача сродни доказательству теоремы Пуанкаре, за это приз в миллион долларов можно получить. Хранение запрещенных сильнодействующих веществ уже в размере 5 граммов, может рассматриваться как их распространение и, согласно статье 234 Уголовного Кодекса Российской Федерации, наказывается ограничением, либо лишением свободы на срок до трёх лет! То есть, если у вас найдут пластину с таблетками, то очень реально попасть всерьез и надолго.

К сожалению, просто огромное количество парней попадается на незнании того простого факта, что стероиды нельзя просто так купить и принести домой в кармане. Более-менее безопасно их получить можно только через проверенного знакомого из рук в руки. А наибольшее количество задержаний покупателей стероидов происходит при получении посылок на почте. Бывает это так: при подписании квитанции о получении посылки к парню сразу подходят сотрудники милиции (или теперь полиции) и сразу «принимают» его. Несчастный получатель пытается доказать, что он добросовестный законопослушный покупатель, купил препарат для себя на законном сайте (обычно, не российском) и не знал о том, что это запрещено. Но у полицаев своя истина и детский лепет паренька уходит в пространство. Меня просто передергивает, когда я в очередной раз читаю о такой истории в новостях, издаваемых полицейским или таможенным управлением. Передергивает, потому что авторы таких новостей выставляют покупателей в виде злостных негодяев-рецидивистов, наркоманов с самого дна, которые за дозу родную мать продадут. Поэтому, еще раз ребята, очень прошу вас. Если вы все-таки решили попробовать химию, то очень серьезно отнеситесь ко всему, что с этим связано, в том числе к приобретению – «побочные эффекты» могут наступить гораздо раньше, чем вы могли бы предположить.

Для целей ознакомления привожу список веществ, за которые можно сесть — список сильнодействующих веществ, применяемых спортсменами, для целей статьи 234 УК РФ:

19-норандростенедиол

19-норандростенедион (эст-4-ен-3,17-дион)

1-тестостерон (17бета-гидрокси-5альфа-андрост-1-ен-3-он)

4-гидрокситестостерон (4,17бета-дигидроксиандрост-4-ен-3-он)

Андростанолон

Андростенедиол

Андростенедион

Боластерон

Болденон

Болдион (андрост-1,4-диен-3,17-дион)

Дегидрохлорметилтестостерон (4-хлоро-17бета-гидрокси-17альфа-метиландрост-1,4-диен-3-он)

Дезоксиметилтестостерон (17альфа-метил-5альфа-андрост-2-ен-17бета-ол)

Дростанолон

Клостебол

Местеролон (1альфа-метиландростанодон)

Метандиенон (метандростенолон) (17бета-гидрокси-17альфа-метиландрост-1,4-диен-3-он)

Метандриол

Метастерон (2альфа,17альфа-диметил-5альфа-андростан-3-он-17бета-ол)

Метенолон

Метил-1-тестостерон (17бета-гидрокси-17альфа-метил-5альфа-андрост-1-ен-3-он)

Метилдиенолон (17бета-гидрокси-17альфа-метилэстр-4,9-диен-3-он)

Метилнортестостерон (17бета-гидрокси-17альфа-метилэстр-4-ен-3-он)

Метилтестостерон

Метилтриенолон (17бета-гидрокси-17альфа-метилэстр-4,9,11-триен-3-он)

N-метилэфедрин

Нандролоноат

Оксаболон

Оксандролон

Оксиместерон

Оксиметолон

Псевдоэфедрин

Сибутрамин и его структурные аналоги

Станозолол

Стенболон

Тренболон

Этилэстренол (19-нор-17альфа-прегн-4-ен-17-ол)

Эфедрин

Это не полный список, с полным можно ознакомиться на сайте www.garant.ru

Ладно, оставим в стороне ужасы нашего несовершенного законодательства и перейдем конкретно к свойствам анаболических стероидов в плане набора мышечной массы. Опытные бодибилдеры утверждают, что начинающему качку набрать 8-10 кг мышц за месяц вполне реально только на одном метане. А если совместить его с декой (Нандролона Деканоатом) то можно и до 15 набрать. Для любого неопытного новичка, который за месяц набирает 1-2 кг, такие массы кажутся просто пределом мечтаний. Не буду спорить, я, считающий себя довольно опытным культуристом, тоже не прочь был бы столько набирать. Я еще не достиг своего желаемого результата и приходится долго тяжело качаться и правильно есть, чтобы набрать пару-тройку кило.

 

В общем, не будем лить воду и признаем сразу – анаболические стероиды очень эффективны для набора мышечной массы, силы, рельефа, а также, в различных сочетаниях, для удержания идеальной формы, как для соревновательных целей, так и просто «для красоты». Вопрос только в дозации, но об этом немного позднее.

Так что можно считать доказанной первое утверждение, что стероиды=большие мышцы (при правильном употреблении!).

Сейчас пару слов о побочных эффектах применения стероидов. Все соединения, содержащие в своем названии (в формуле) цифру 17 (наличие метильного радикала -СН3 в положении 17) гепатотоксичны, то есть негативно влияют на печень. Степень этого влияния зависит от доз и длительности принятия препарата. Другие побочные эффекты, случающиеся при приеме метандростенолона (метана) и других наиболее распространенных стероидов — это угревая сыпь, снижение выработки собственного тестостерона и повышенное давление. Еще одним недостатком является то, что по окончании их приема уровень достигнутых результатов может достаточно быстро вернуться к исходному – вес достаточно быстро начнет снижаться, а качество остающейся мускулатуры ухудшаться. Ведь все просто – когда ты принимаешь в сутки 1500 мг тестостерона в день и быстро растешь, а потом заканчиваешь курс и живешь на своих 20-25 мг тестостерона, его не хватает на обслуживание такой массы и тело борется с тем, что считает лишним. Чем выше взлет, тем ниже падение.

Наиболее значительным негативным эффектом специалисты считают снижение выработки собственного тестостерона. Дело в том, что такой эффект обычно необратим уже после нескольких циклов приема любых синтетических аналогов тестостерона. Организм считает, что тестостерона становится слишком много, и отключает его собственное производства сразу на всех уровнях, а таких уровней три — два из них в головном мозге, и только один на уровне яиц. А именно они, родимые, страдают более всего, потому что перезапустить их уже сложнее. Не буду уподобляться писакам далеким от культуризма и впустую пугать страшилками, что писька сразу отвалится. Но риск бесплодия и импотенции действительно увеличивается пропорционально срокам и дозам принимаемых препаратов синтетического тестостерона.

Помимо этого, значительная часть лишнего, по мнению организма, тестостерона быстро преобразуется в женский гормон эстроген, при воздействии энзима ароматазы. Отсюда, явление гинекомастии у некоторых качков – то есть сиськи вырастают. Эстроген растит жир по женскому типу — жир откладывается на бедрах и на животе.

Приведу несколько историй из жизни моих близких знакомых из уже не раз упоминаемой мною полуподвальной качалки. Вместе со старым тренером в том зале работал и работает молодой тренер Алексей – парень около 30 лет. Очень хорошо сложен, участвует в соревнованиях местного уровня. Вот только уже в 26 лет он полностью облысел. О других особенностях его личной жизни мне неизвестно. Другой посетитель данного зала, тоже завсегдатай и участник соревнований по пауэрлифтингу за год превратился в гору сала. Его буквально разнесло именно в талии и на лице. Третья история – самая нашумевшая в нашем городе и самая печальная. Зимой 2011 года от гриппа за 4 дня умер очень известный в местных кругах профессиональный бодибилдер Миша Аронов. Жалко человека очень, просто потому, что он был хорошим парнем. В возрасте 35 лет, он был очень обеспеченным бизнесменом и очень опытным культуристом. Как выяснилось позднее, иммунитет был ослаблен после курса.

У 100% профессиональных культуристов были, есть и будут проблемы, вызванные приемом стероидов в тех дозах, которые они принимают. Качки старой закалки, экспериментировавшие на себе и принимающие стероидами килограммами, очень многие стали инвалидами или просто рано состарившимися больными и неважно выглядящими мужчинами. Даже такие иконы культуризма, как Арни (проблемы с сердцем) и Ронни Колеман (гинекомастия, печень) в свое время пострадали от побочки. Самой яркой и стремительно пролетевшей звездой стероидного бодибилдинга я считаю Флекса Уиллера, он был очень красив и в свое время успел много чего завоевать. Сейчас парень просто разваливается. Первыми отказали почки. О нем много написано, почитайте, если интересно.

На сегодняшний день наиболее эффективными и наименее опасными среди стероидов считаются блокаторы ароматазы, эти вещества не растят уровень тестостерона, но не дают имеющемуся запасу тестостерона превращаться в эстроген. Это действительно действенные стероиды, рост анаболизма при блокаде ароматазы может достигать 600%, что примерно в 1,5-2 раза мощнее действия синтетических аналогов тестостерона. Также количество побочных эффектов у них ниже или вообще отсутствует, так как это не гормональные препараты. Маленькое но — эти препараты в десятки раз дороже обычных стероидов. И второе маленькое но – в РФ они тоже входят в список веществ, за которые могут, как репку, посадить.

 

Профи культуризма считают, что перед началом приема экзогенного (синтетического) тестостерона и других стероидов надо соблюсти 3 правила:

 

1)Достичь, как минимум, 25 лет

2)Прозаниматься не менее 3х лет

3)Узнать все, что можно о имеющихся препаратах, дозах и циклах применения.

 

Вернемся к началу статьи — почему же 16-летнего парня даже истинные защитники метана и деки послали обратно в школу? Дело в том, что эндокринная система с ее сотнями гормонов, прогормонов, энзимов, медиаторов, рецепторов и прочих неведомых зверушек это очень тонко отлаженная система, становление которой как раз приходится на подростковый период и у нормального здорового парня идет с 14 до 25-30 лет. Всем хорошо известно, что мальчик становится мужчиной именно в этот период и именно подростковой время несет с собой наиболее значительные изменения. Наука эндокринология все еще довольно молодая наука и не может объяснить очень многое, что происходит в этот момент в теле парня. Но одно ясно и уже проверено немалым горьким опытом – неосторожное внешнее вмешательство в гормональные процессы на этом возрастном этапе могут настолько нарушить баланс выработки собственных гормонов, что придется на таблетках и укольчиках провести всю оставшуюся жизнь. А прием синтетических аналогов тестостерона, коими и являются метан и дека в 16,17,18,19 лет неминуемо баланс нарушит.

В общем, если тебе менее 25, про стероиды просто забудь. Даст Бог, когда тебе исполнится заветный возраст, в мире культуризма появятся новые методики и препараты, способные безопасно растить массу или ты просто заметишь те, которыми уже пользуются тысячи «натуралов».

Далее, правило номер 2 – перед рассмотрением возможности/необходимости приема стероидов прозаниматься в зале не менее 3х лет. Почему?! Я щас накачаться хочу! Не хочу ждать и тупо поднимать железки так долго!

Так почему? – Потому что за это время ты сможешь прочувствовать, где твой генетический потолок. Может быть, ты – генетический уникум и наберешь 120 кг мышечной массы сам по себе просто на протеине и манной каше. Такие случаи не так уж редки. Обычно именно такие уникумы и становятся известными на весь мир чемпионами бодибилдинга. Все без исключения парни, которые когда-либо побеждали в Мистере Олимпия, именно те, о ком мы сейчас говорим.

К сожалению, большая часть из нас таковыми уникумами не является. Но все же срок в 3 года определен не случайно. За это время, начинающий культурист, если не бросит заниматься и утверждается в желании построить красивое тело, успевает набрать опыт и попробовать различные виды и режимы тренировок, питания и приема негормонального спортивного питания. Именно опыт даст тебе понимание как реагирует твое тело на те или иные виды тренинга или питания, на ту или иную диету или добавку. И именно после такого опыта ты сможешь правильно определить свои генетические рамки и свои желания в сфере дальнейшего набора массы. Все мы очень разные, что работает у одного, для другого вызовет истощение, или, наоборот, набор жира. Но сейчас разработаны сотни программ тренировок и питания. Ты обязательно сможешь найти что-то, что будет твое на 100%. Могу прямо сейчас посоветовать пару вещей по питанию и тренингу, которые ты точно не пробовал, если тебе сложно набрать массу и которые тебе точно помогут. Первое — увеличь калорийность потребляемой пищи до 10000-12000 килокалорий в день. Не ной, что ты и так много ешь – приведенная мной цифра это и есть ключ к генетике. И профи об этом знают. Тело перестает думать о том, что еды ему не хватает и начинает мощно растить мышцы. Второе – качай только базу – только жим лежа, становая и приседания. И на каждой тренировке делай рекорд – с каждой тренировкой должны расти веса или количество повторений. Естественно период только базовых упражнений должен когда либо закончиться. Это ты должен сам определить – ответ тебе даст твое тело. И таким ответом должен стать прорыв в процессе набора мышечной массы.

Третье правило о приеме стероидов – узнать о них все. Я нисколько не совру, если скажу, что большинство их тех, кто впервые пробует качаться с применением стероидов, знает о них недостаточно, чтобы самостоятельно построить адекватный курс приема. Я сам отношусь к таким, поэтому не буду клеймить качков-новичков в глупости. Просто постарайся услышать не одно-два-три, а хотя бы пару десятков мнений авторитетных людей. Читай статьи специалистов, разговаривай с качками, которые доказали, что им можно доверять. Определение длительности циклов и дозации это жизненно важные решения. К ним надо подходить наиболее серьезно и ответственно.

 

А сейчас перейду к рекламе продуктов со своего магазина. Э-э-й! Не смей закрывать страницу и уходить с сайта! Помимо питания и тренировок есть способы ускорить прогресс без употребления стероидов. Да, я лично и тысячи бодибилдеров и спортивных диетологов на своем опыте и исследованиях доказали, что альтернатива стероидам есть! И все проще и доступнее, чем кажется. Многие «химики» убеждены, что накачаться без синтетического тестостерона невозможно – все остальное не работает. Так ли это действительно? Большие мышцы=стероиды? Нет друзья, не всегда .

Во-первых, хочу рассказать про экдистерон. Грубо говоря, это растительный стероид, мощно стимулирующий белковый синтез. С его помощью растения наращивают себе плотные слои стебля для защиты от насекомых. Так вот, биосинтез новых белковых соединений при приеме экдистерона увеличивается на 200-250%, то есть ты сможешь набрать в два-два с половиной раза больше мышечной массы, чем обычно. Это очень неплохой результат, учитывая, что стероиды дают рост массы на 450-500%, но несут с собой массу рисков для здоровья. Экдистерон же не только безопасен, но и полезен для здоровья во всем его комплексе.

Во-вторых, следует рассмотреть множество бустеров тестостерона. Самый известный из них среди культуристов это трибулюс террестрис или якорцы стелющиеся, если по-русски. Это хороший и быстродействующий потенцер и тестобустер. Можем предложить более эффективный и безопасный бустер, самый действенный продукт для долгосрочного увеличения уровня тестостерона и улучшения потенции  – эврикому. Малазийцы называют это растение Посох Будды и Лекарство от тысячи болезней. Все потому что это очень сильный антиоксидант – то есть антикатаболик и естественный стимулятор выработки собственного тестостерона. Уровень свободного (анаболически активного) тестостерона растет на 50% после 2х месячного курса приема эврикомы и, что самое главное, закрепляется на этом уровне. Это очень действенный, но довольно дорогой бустер тестостерона. Но есть дешевле, например, Д-аспарагиновая кислота. Это молочный белок, на котором телята растут и превращаются в быков. Можно просто пить очень много молока, и расти, но, если вы не можете пить очень много молока, мы можем предложить вам чистый изолят этого белка. Д-аспарагиновая кислота растит собственную продукцию тестостерона в среднем на 30% за месяц.

К тестостерону можно зайти с другой стороны и попробовать усилить его анаболический эффект без увеличения его концентрации в крови. Этому способствует новое для российского рынка соединение всем известного карнитина – карнитина тартрат. Это вещество растит количество рецепторов тестостерона в клетках, тем самым увеличивая его анаболический эффект.

На вышеописанных веществах список нашей продукции не ограничивается. А вообще в продаже вы сможете найти десятки различных соединений в чистом виде и препаратов из них для естественного увеличения продукции тестостерона и защиты от катаболизма. Так что, друзья, большие мышцы не обязательно требуют химии! Кушайте протеинчик, растите тестостерон и будьте красивы и здоровы!

И не творог, не сметана не заменят нам — Метана! — Статьи (Miscellaneous) — Каталог статей

Метандростенолон (Данабол)

Метандростенолон (Данабол) — таблетки

Метандростенолон (известен также под названиями: Дианабол, Данабол, Неробол, DBOL, Метандиенон в бодибилдинге широко распространено сленговое название «Метан«, менее распространенные торговые марки — Анаболин, Бионабол, Дегидрометилтестостерон, Метастенол, Новабол, Перабол, Перболин, Стенолон, Анаборал, Ванабол и многие другие) — применяемый внутрь анаболический стероид изначально синтезированный доктором John Ziegler и выпущенный в США в начале 60-х годов прошлого века компанией Ciba.[1]. Изначально метандростенолон использовался для ускорения восстановления и лечения ожогов и даже для повышения общего тонуса у женщин, а вскоре получил широкое распространение в бодибилдинге как средство для увеличения мышечной массы, до тех пор пока его не запретила FDA. Тем не менее Данабол до настоящего времени доступен без предписания в таких странах как Мексика (торговое наименование Reforvit-b), во многих азиатских странах и в странах Восточной Европы (Молдова — Balkan Pharmaceuticals; Румыния — Terapia; Польша — Jelfa;). В России метандростенолон продается как Неробол.

На сегодняшний день имеется большое количество дискредитирующей информации о Данаболе. Авторы преувеличивают токсические свойства и занижают анаболическую активность. Тем не менее практика показывает, что курс метандростенолона длительностью около 6 недель в дозе 30 мг в сутки может увеличить мышечную массу на 8-10 кг, с последующей потерей 2-5 кг (так называемый феномен отката). Феномен отката можно свести к минимуму, если курс будет составлен правильно.

Стероидный профиль

Эффекты Данабола

  • Основной эффект метандростенолона проявляется в быстром увеличении мышечной массы, за счет активации синтеза протеина, гликогенолиза.[2] Метандростенолон не разрушается в печени и не связывается с связывающим половые гормоны глобулином, поэтому значительно мощнее эквивалентного количества тестостерона.
  • Попутно увеличиваются силовые показатели
  • Усиливается аппетит
  • Незначительно сжигается жир
  • Укрепляется костная система
  • Метандростенолон имеет относительно слабое андрогенное действие (50% по сравнению с тестостероном), тем не менее оно имеет место быть in vivo.[3]
  • В исследованиях было показано, побочные эффекты начинают проявляться в большинстве случаев при превышении дозы Данабола более 30 мг в сутки

Побочные эффекты Метандростенолона

Гинекомастия

Гинекомастия возникает в результате конверсии части метандростенолона в эстрогены — метилэстрадиол. Для предотвращения развития данного побочного эффекта применяются антиэстрогены — Нолвадекс или Кломид. Эти препараты практически на 100% эффективны для предотвращения гинекомастии.

Токсичность для печени

В виду того, что метандростенолон имеет метильную группу в 17α положении, данный препарат оказывает умеренное токсическое действие на печень. Метильная группа препятствует разрушению Данабола в печени, и дает возможность применять препарат орально (внутрь). Это также снижает связывание Данабола со связывающим половые гормоны глобулином.

Задержка жидкости

Еще один довольно распространенный побочный эффект метандростенолона, который связан с эстрогенами. В тоже время, задержка жидкости происходит главным образом в мышцах, что создает впечатление большего объема мускулатуры. После окончания курса метандростенолона лишняя жидкость выводится и вес снижается на 10-50% от набранного. Этого не наблюдается при использовании антиэстрогенов.

Другие побочные эффекты метандростенолона

  • Повышение артериального давления. Проблему можно решить, если использовать во время курса антиэстрогены и гипотензивные средства.
  • Повышение сексуальной ативности во время курса и временное снижение после курса.
  • Атрофия яичек возникает при длительных курсах с использованием больших доз Данабола.
  • Акне во время курса
  • Алопеция (потеря волос)
  • У женщин метандростенолон вызывает маскулинизацию.
  • В случае злоупотребления или генетической предрасположенности возможно развитие гипертрофии миокарда.

Курс метандростенолона

Данный курс метандростенолона подходит мужчинам старше 21 года для увеличения мышечной массы, при отсутствии противопоказаний (повышенное артериальное давление, заболевания сердца, гипертрофия предстательной железы, заболевания печени и некоторые другие).

  • Рекомендуется не превышать суточную дозу более 30 мг
  • Курс метандростенолона начинается с 10 мг
  • Через 2-3 дня доза увеличивается до 20 мг в сутки, разделенные на два приема
  • В этот же день начинается прием Нолвадекса или Кломида. Нолвадекс принимается в дозе 10 мг в сутки в любое время.
  • Еще через 2-3 дня можно поднять дозу до 30 мг, разделенную на 3 приема
  • В течение последней недели постепенно снижаем дозу метандростенолона до нуля.
  • Прием нолвадекса продолжается еще 2 недели с последующей отменой
  • Необходимо следить за артериальным давлением. В случае повышения необходимо снизить дозу, либо начать прием гипотензивных средств (Эналаприл по 5 мг)
  • На последней недели приема Данабола можно включить в курс тестостероновый бустер на 3-4 недели, для более быстрого восстановления секреции тестостерона в организме и предотвращения феномена отката.
  • Не забывайте, что прием анаболических стероидов должен быть согласован с врачом, так как возможны противопоказания.
  • Для получения максимального эффекта и снижения потери мышечной массы после курса рекомендуется применять спортивное питание для набора мышечной массы и соблюдать диету для набора мышечной массы.

Комбинированные курсы Данабола

Учитывая довольно высокую частоту побочных эффектов метандростенолона и узкую широту положительных эффектов, многие авторы рекомендуют использовать данный препарат в сочетании с другими анаболическими стероидами. При этом доза Метандростенолона может колебаться от 10 до 30 мг. Комбинирование позволяет увеличить эффективность курса, вместе с этим снизить частоту побочных эффектов, в виду различной фармакодинамики препаратов.

Для увеличения мышечной массы метандростенолон сочетают с:

Почему нельзя принимать анаболические стероиды

Мы уже писали о комплексе Адониса – как меняется психология некоторых людей при занятии бодибилдингом, когда они не могут остановиться в накачивании своего тела и готовы на любые жертвы, включая употребление анаболических стероидов.

Зачем?

На вопрос, вынесенный в заголовок, люди, стремящиеся стать огромными с помощью стероидов, не могут дать вразумительный ответ. К здоровому образу жизни чрезмерная мышечная масса (да еще и полученная с помощью стероидов) не имеет никакого отношения.

Быть красивым?  – но такое нравится лишь очень узкому кругу людей. И чем больше человек – тем Уже этот круг.

Быть сильным? Но можно добиться достаточного уровня силы и без стероидов.

Большие стероидные качки расхаживают по спортзалам с видом своего превосходства, снисходительно поглядывая на “дрищей”. С другой стороны, в залах все больше крепких адекватных зожников, которые с такой же снисходительностью и жалостью поглядывают на огромных качков.

В принципе, ребята на стероидах мало чем отличаются от ребят, закачивающих себе в мышцы синтол (как на фото выше). Тоже вкалывают (волшебные уколы), тоже вредят своему здоровью, тоже думают, что выглядят офигенно.

Стероиды дают эффект даже если вообще не заниматься в спортзале

Фитнес-эксперт Сергей Струков комментирует: “Запрещенное работает, любой качок знает, что метан перекроет самую крутую комбинацию из добавок.

Проводилось такое исследование: взяли три группы людей. Одна – ничего не делала и принимала стероиды (тестостерона энантат, 500 мг в неделю), вторая – и тренировалась, и принимала стероиды, третья – просто тренировалась без стероидов.

При этом результаты интересные: больше всего мышечной массы прибавляют те, кто принимает и тренируется, а вот на втором месте — те, кто только колется, и только на третьем — те, кто ударно вкалывает в зале без стероидов”.

Другими словами, если вы видите огромного качка – не всегда это означает, что он пОтом и кровью сделал себе эти мышцы. Даже тренируясь одной левой раз в неделю (или не тренируясь вообще), он добавляет массы лучше, чем те, кто упирается без стероидных уколов.

Последствия или почему не нужно принимать анаболические стероиды

Вот мнение Струкова: в первый год занятий вам не нужны не то что стероиды – даже обыкновенные добавки. До приёма добавок, есть более важные задачи: 1. научиться выполнять упражнения правильно и безопасно; 2. устранить серьёзные дисбалансы; 3. научиться строить тренировочный процесс на основе освоенных упражнений.

По мере вашего развития и накопления опыт работы в силовых тренировках имеет смысл найти научные данные, подтверждающие эффективность приёма добавок. Например, посмотрите действующие рекомендации ACSM или ISSN.

Зожник сделал это за вас и вот единственные 4 добавки, эффективность которых доказана наукой. Заметьте – там, например, нет L-Карнитина, который в некоторых кругах называют “дорогой мочой”. 

Но самая главная ошибка: анаболические андрогенные стероиды и другие сильнодействующие лекарства, назначенные самостоятельно и/или без показаний по здоровью.

В современном обществе пока еще не считается зазорным ходить в подобном стероидном теле. Хотя на наш взгляд такие ребята не сильно дальше ушли от тех, то закачивает себе синтол в мышцы. К здоровью или красоте это имеет прямо противоположное отношение.

Дадим слово фитнес-эксперту, реабилитологу, автору книг по фитнесу Сергею Струкову:

Поначалу стероиды могут обеспечить приросты мышечной массы даже без тренировок. Но вы никогда не научитесь тренироваться правильно, если сделаете ставку на гормоны. Более того, через некоторое время вы будете выкладываться в зале только «на курсе».

Заботливый продавец стероидов уверит вас, что гормоны безопасны, но это далеко не так.

Во-первых, индивидуальная реакция на препараты между людьми различается и не факт, что вы будете тем счастливчиком, у которого побочные эффекты обратимы.

Во-вторых, сочетание препаратов, которое зачастую применяют, делает эффект непредсказуемым.

В-третьих, «спортивные дозы» в десятки, а иногда и в сотни раз превышают терапевтические, о потенциальной безопасности которых вам могут говорить.

В-четвёртых, схемы приёма по медицинским показаниям также существенно отличаются от «спортивных» схем. (Добавим, что и по разному действовать на разных людей).

В-пятых, рынок стероидов «чёрный», а значит, вам могут продать что угодно, вместо желаемого, не говоря уже о прямом отношении к уголовной ответственности.

Но самая главная суть негативного действия больших доз стероидов: они задействуют (и истощают) ресурсы организма, которые в норме никогда не используются. Образно говоря, вы вручную ускоряете стрелки ваших жизненных часов, прожигаете ресурсы своего организма, приближаете смерть.

Те, кто принимает стероиды, если вы смогли дочитать до этого места: попробуйте снова ответить на вопрос “Зачем?”

 

Читайте также на Зожнике:

Натуральные способы повышения тестостерона

Бустеры тестостерона: научный взгляд на эффективность

Когда эффективнее принимать белки и углеводы

Все базовые упражнения с правильной техникой

Какая минимальная нагрузка дает эффект на рост мышц?

Метандростенолон (данабол) — Atletizm.com.ua

Метандростенолон (данабол)

Метандростенолон – это анаболический стероидный препарат, известный как Наносим, Дианабол, Метандиенон.

Сокращенно в залах его называют метан. Это оральный препарат, сильно воздействующий на обмен белка в организме.

Этот эффект помогает лучшему усвоению белка организмом, что в свою очередь способствует строительству новых белковых структур, то есть, строительству мышц. Кроме этого он обеспечивает кальцием костную ткань.

Для чего используют метан

Воздействие метандростенолона дает быстрый прирост мышечной массы и увеличивает силовые показатели. Это происходит за счет задержки воды в организме. Много спортсменов употребляют метандростенолон, иногда увеличивая мышечную массу от 1 до 2-х кг в течение недели.

Перед соревнованиями прием этого препарата нежелателен, так как при его употреблении вода в организме удерживается, и четкого мышечного рельефа не получается. Ведь в это время нужно подсушиться, снизить уровень воды в организме и снизить уровень подкожного жира.

Оптимальной считается доза от 15 до 40 мг препарата в день. Но многие спортсмены значительно превышают эту дозировку, надеясь на более сильный результат.

Но для спортсменов, не употреблявших ранее стероидных препаратов, будет достаточно дозы от 15 до 20 мг в сутки. Кроме этого при применении этого препарата нужно учитывать и вес спортсмена.

С чем можно применять метан

В некоторых случаях для увеличения результата метандростенолон комбинируется с Дека-дураболином или Примаболаном в дозировке 200 мг в сутки. Также часто для достижения быстрых и значительных результатов комбинируется еженедельный прием Дека-дураболина в дозировке от 200 до 400 мг и Метандростенолона от 20 до 30 мг. Такое сочетание дает хороший результат.

Но вот прием Метандростенолона и Анаполона не рекомендован. Дело в том, что данные препараты обладают сходным действием, и вместо усиления действия эффект от их приема будет минимальным.

Для быстрого увеличения силовых показателей принимают такое сочетание: Метандростенолон и Оксандролон. Таким же эффектом обладает сочетание: Метандростенолон и Винстрол. Но такое сочетание дает значительный прирост силы и совсем незначительный прирост массы.

Действие препарата продолжается от 3 до 4 с половиной часов, принимают обычно 2-3 раза в день, как правило во время приема пищи, чтобы не вызвать проблем с желудком.

После приема препарата уровень тестостерона в организме в некоторых случаях увеличивается в 5 раз. Но после окончания приема препарат прекращает воздействие на организм на третий день.

Минусы метана

К минусам препарата можно отнести то, что он все же токсичен для печени, сильно задерживает воду, в некоторых случаях повышает кровяное давление. Также обладает коротким временем действия: от 3 до 4 с половиной часов.

Плюсы метана

Но серьезный плюс этого препарата в том, что при его употреблении выработка кортизола уменьшается на 50%. А кортизол — это гормон, принимающий участие в процессе распада мышечных белков. То есть, рост мышц происходит практически без потерь, так как процесс распада сведен к минимуму.

Побочные эффекты метана

Также нужно знать о побочных эффектах при употреблении этого препарата. Это повышенная нагрузка на печень, что происходит по причине удержания воды в организме.

Также у некоторых спортсменов повышается артериальное давление, увеличивается сердцебиение и частично препарат превращается в эстроген.

Эстроген — это женский половой гормон. При этом возможно развитие гинекомастии.

Гинекомастия — это увеличение молочной железы у мужчин с гипертрофией желез и жировых тканей. Иногда это заболевание возникает у спортсменов при резком прекращении нагрузок и у людей, испытывающих сильные психологические нагрузки.

Это может быть вызвано и другими проблемами, вроде голодания и др. То есть, это изменение соотношения в плазме крови между тестостероном и эстрадиолом в пользу эстрадиола.

Эстрадиол — это женский половой гормон. Как следствие, гинекомастии часто подвергаются мужчины в возрасте старше 50, подростки в период полового созревания и иногда младенцы. То есть, именно те возрасты, у которых возможны эти изменения.

Кроме этого возможно появление угревой сыпи на груди и руках, и у людей, склонных к облысению, начинается быстрый процесс облысения.

Уровень тестостерона, вырабатываемого Вашим организмом при употреблении препарата, снижается иногда до 40% в день. И это при применении дозы в 20 мг. Но при приеме до 20 мг метандростенолона в сутки риск побочных эффектов минимален.

По материалам: Атлетизм.com.ua

Подробности
Просмотров: 6501

Эффекты и механизм действия метана на моторную функцию подвздошной кишки

Задний план: Метан был связан с синдромом раздраженного кишечника с преобладанием запоров, замедляя время кишечного транзита за счет увеличения сократительной активности. Однако точный механизм, лежащий в основе этого эффекта, остается неясным. Поэтому мы исследовали механизмы, лежащие в основе влияния метана на сократительную активность, и опосредованы ли такие эффекты нервными импульсами или мышечными сокращениями.

Методы: Мы подключили полоски подвздошных мышц морской свинки к датчику силы/натяжения и измерили амплитуды сокращения в ответ на стимуляцию электрическим полем (EFS; 1, 2, 8, 16 Гц) после инфузии метана в присутствии тетрадотоксина (ТТХ), атропина, гуанетидин или GR 113808. Затем мы выполнили визуализацию кальция с использованием Oregon Green 488 BAPTA-1 AM, чтобы визуализировать изменения флуоресценции кальция в ответ на EFS после инфузии метана в присутствии TTX, атропина или раствора с высоким содержанием K + . .

Ключевые результаты: Метан значительно увеличивал амплитуду сокращения (P<0,05), в то время как лечение ТТХ устраняло такое сокращение. Вызванное метаном увеличение амплитуды ингибировалось, когда после инфузии атропина применялась низкочастотная (1, 2 Гц) EFS (P<0,05). Ни гуанетидин, ни GR 113808 не оказывали существенного влияния на амплитуду сокращения. Метан значительно увеличивал флуоресценцию кальция, в то время как это увеличение ослаблялось после инфузии атропина (P<.05). Хотя флуоресценция кальция увеличивалась в растворе с высоким содержанием К + при предварительной обработке ТТХ, интенсивность флуоресценции оставалась неизменной после введения метана.

Выводы и выводы: На действие метана на кишечник влияет холинергический путь энтеральной нервной системы. Наши данные подтверждают классификацию метана как газотрансмиттера.

Ключевые слова: кальций; подвижность подвздошной кишки; метан; гладкая мышца.

Микробиом рубца, связанный с выбросами метана жвачным скотом | Журнал зоотехники и биотехнологии

  • МГЭИК. Изменение климата, 2014 г.: сводный отчет. В: Пачаури Р.К., Мейер Л.А., редакторы. Вклад рабочих групп I, II и III в пятый оценочный доклад межправительственной группы экспертов по изменению климата.Женева: МГЭИК; 2014. с. 151.

    Google ученый

  • Христов А.Н., О Дж., Ли С., Мейнен Р., Монтес Ф., Отт Ф. и другие. Снижение выбросов парниковых газов в животноводстве. В: Gerber PJ, Henderson B, Makkar HPS, редакторы. Обзор вариантов выбросов, отличных от CO 2 . Рим: ФАО; 2013. с. 226.

  • McAllister TA, Meale SJ, Valle E, Guan LL, Zhou M, Kelly WJ, et al. Использование геномики и транскриптомики для определения стратегий снижения метаногенеза в рубце.J Anim Sci. 2015;93:1431–49.

    КАС пабмед Статья Google ученый

  • Джонсон К.А., Джонсон DE. Выбросы метана от крупного рогатого скота. J Anim Sci. 1995; 73: 2483–92.

    КАС пабмед Статья Google ученый

  • Мюррей Р.М., Брайант А.М., Ленг Р.А. Показатели продукции метана в рубце и толстой кишке овец. Бр Дж Нутр. 1976; 36: 1–14.

    КАС пабмед Статья Google ученый

  • Мартин С., Моргави Д.П., Доро М.Снижение выбросов метана у жвачных животных: от микробов до масштабов фермы. Животное. 2010;4:351–65.

    КАС пабмед Статья Google ученый

  • Моргави Д.П., Форано Э., Мартин С., Ньюболд С.Дж. Микробная экосистема и метаногенез у жвачных животных. Животное. 2010;4:1024–36.

    КАС пабмед Статья Google ученый

  • Кнапп Дж.Р., Лаур Г.Л., Вадас П.А., Вайс В.П., Трикарико Дж.М.Приглашенный обзор: кишечный метан в молочном животноводстве: количественная оценка возможностей и воздействия сокращения выбросов. Дж. Молочная наука. 2014;97:3231–61.

    КАС пабмед Статья Google ученый

  • Кумар С., Чоудхури П.К., Карро М.Д., Гриффит Г.В., Дагар С.С., Пуния М. и др. Новые аспекты и стратегии снижения выбросов метана от жвачных животных. Приложение Microbiol Biotechnol. 2014; 98:31–44.

    КАС пабмед Статья Google ученый

  • Бошемин К.А., Кройцер М., О’Мара Ф., Макаллистер Т.А.Управление питанием для борьбы с кишечным метаном: обзор. Aust J Exp Agric. 2008;48:21–7.

    КАС Статья Google ученый

  • Эттвуд Г.Т., Альтерманн Э., Келли В.Дж., Лихи С.К., Чжан Л., Моррисон М. Изучение геномов метаногена рубца для определения целей для стратегий снижения выбросов метана. Anim Feed Sci Technol. 2011;166-67:65–75.

    Артикул КАС Google ученый

  • Leahy SC, Kelly WJ, Altermann E, Ronimus RS, Yeoman CJ, Pacheco DM, et al.Последовательность генома метаногена рубца Methanobrevibacter ruminantium открывает новые возможности для контроля выбросов метана жвачными животными. Плос Один. 2010;5(1):e8926.

  • Райт А. Д., Кеннеди П., О’Нил С. Дж., Туви А. Ф., Поповски С., Ри С. М. и др. Снижение выбросов метана у овец путем иммунизации против метаногенов рубца. вакцина. 2004; 22:3976–85.

    КАС пабмед Статья Google ученый

  • Пинарес-Патино К.С., Хики С.М., Янг Э.А., Доддс К.Г., Маклин С., Молано Г. и др.Оценки наследуемости выбросов метана от овец. Животное. 2013;7:316–21.

    ПабМед ПабМед Центральный Статья Google ученый

  • Гупи Дж. П., Робинсон Д. Л., Вудгейт Р. Т., Дональдсон А. Дж., Одди В. Х., Верко Ч. П. и др. Оценки повторяемости и наследуемости продукции метана у овец с использованием портативных накопительных камер. Аним Прод Наука. 2015;56:116-22. http://dx.doi.org/10.1071/AN13370.

  • де Хаас Й., Виндиг Дж.Дж., Калус М.П.Л., Дейкстра Дж., де Хаан М., Баннинк А. и др.Генетические параметры прогнозируемого образования метана и потенциал сокращения кишечных выбросов посредством геномной селекции. Дж. Молочная наука. 2011;94:6122–34.

    ПабМед Статья КАС Google ученый

  • Хунгейт RE. Рубец и его микробы. Нью-Йорк: академический; 1966.

    Google ученый

  • Ньюболд С.Дж., де ла Фуэнте Г., Беланче А., Рамос-Моралес Э., Макьюэн Н.Р.Роль инфузорий простейших в рубце. Фронт микробиол. 2015;6:1313.

    ПабМед ПабМед Центральный Статья Google ученый

  • Орпин К.Г. Грибы в деградации жвачных животных. В: Семинар по сельскохозяйственным наукам: деградация материала клеточных стенок растений. Лондон: Совет по сельскохозяйственным исследованиям; 1981. с. 129–50.

    Google ученый

  • Резайан М., Бикс Г.В., Паркер Д.С.Распределение и оценка анаэробных зооспоровых грибов по пищеварительному тракту овец. Микол рез. 2004; 108:1227–33.

    ПабМед Статья Google ученый

  • Янссен П.Х., Кирс М. Структура сообщества архей рубца. Appl Environ Microbiol. 2008;74:3619–25.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Груби Д., больничная касса Делафонда.Recherches sur des animalcules se devélopant en grand nombre dans l’estomac et dans les intestins pemdant la пищеварение животных травоядных и плотоядных. CR Hebd Seances Acad Sci. 1843; 17: 1304–1308.

    Google ученый

  • Хунгейт RE. Исследования ферментации целлюлозы. III культивирование и выделение целлюлозоразрушающих бактерий из рубца крупного рогатого скота. J Бактериол. 1947; 53: 631–45.

    КАС пабмед ПабМед Центральный Google ученый

  • Орпин К.Г.Исследования на жгутиконосцах рубца Neocallimastix frontalis . J Gen Microbiol. 1975; 91: 249–62.

    КАС пабмед Статья Google ученый

  • Кентерс Н., Хендерсон Г., Джейнатан Дж., Киттельманн С., Янссен П.Х. Выделение ранее некультивируемых бактерий рубца путем разбавления до исчезновения с использованием новой жидкой культуральной среды. J Microbiol Meth. 2011; 84: 52–60.

    Артикул Google ученый

  • Маккейн Н., Генк Б., Снеллинг Т.Дж., Уоллес Р.Дж.Дифференциальное восстановление генов 16S рРНК бактерий и архей из пищеварительного тракта рубца в ответ на глицерин в качестве криопротектора. J Microbiol Meth. 2013;95:381–3.

    КАС Статья Google ученый

  • Хендерсон Г., Кокс Ф., Киттельманн С., Мири В.Х., Зетхоф М., Ноэль С.Дж. и др. Влияние методов выделения ДНК и методов отбора проб на видимую структуру микробных сообществ рубца коров и овец. Плос Один. 2013;8:e74787.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Kittelmann S, Seedorf H, Walters WA, Clemente JC, Knight R, Gordon JI, et al.Одновременное секвенирование ампликонов для изучения моделей совместного присутствия бактериальных, архейных и эукариотических микроорганизмов в микробных сообществах рубца. Плос Один. 2013;8:e47879.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Тайменсен Л.Д., Макаллистер Т.А. Анализ структуры сообщества метаногенов, ассоциированных с простейшими рубца, выявил предвзятость в универсальных архейных праймерах. Appl Environ Microbiol. 2012;78:4051–6.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Чжоу М., Макаллистер Т.А., Гуань Л.Л. Молекулярная идентификация метаногенов рубца: технологии, достижения и перспективы. Anim Feed Sci Technol. 2011;166-67:76–86.

    Артикул КАС Google ученый

  • Creevey CJ, Kelly WJ, Henderson G, Leahy SC. Определение культивируемости бактериального микробиома рубца.Микроб Биотехнология. 2014;7:467–79.

    ПабМед ПабМед Центральный Статья Google ученый

  • Хендерсон Г., Кокс Ф., Ганеш С., Йонкер А., Янг В., Янссен П.Х. Состав микробного сообщества рубца варьируется в зависимости от диеты и хозяина, но основной микробиом встречается в широком географическом диапазоне. Научный доклад 2015; 5:14567.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Janssen PH.Влияние водорода на образование метана в рубце и баланс ферментации через кинетику микробного роста и термодинамику ферментации. Anim Feed Sci Technol. 2010; 160:1–22.

    КАС Статья Google ученый

  • Neill AR, Grime DW, Dawson RMC. Превращение метильных групп холина через триметиламин в метан в рубце. Биохим Дж. 1978; 170:529–35.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Poulsen M, Schwab C, Borg JB, Engberg RM, Spang A, Canibe N, et al.Метилотрофный метаноген Thermoplasmata участвует в уменьшении выбросов метана из бычьего рубца. Нац коммун. 2013;4:1428.

  • Kittelmann S, Seedorf H, Walters WA, Clemente JC, Knight R, Gordon JI, et al. Одновременное секвенирование ампликонов для изучения моделей совместного присутствия бактериальных, архейных и эукариотических микроорганизмов в микробных сообществах рубца. Плос Один. 2013;8:e103171.

    Артикул КАС Google ученый

  • Моргави Д.П., Мартин С., Жуани Дж.П., Ранилла М.Дж.Простейшие рубца и метаногенез: непростая причинно-следственная связь. Бр Дж Нутр. 2012; 107: 388–97.

    КАС пабмед Статья Google ученый

  • Zhou M, Chung YH, Beauchemin KA, Holtshausen L, Oba M, McAllister TA, et al. Взаимосвязь между метаногенами рубца и выработкой метана у молочных коров, получавших рационы с добавками кормовых ферментов. J Appl Microbiol. 2011; 111:1148–58.

    КАС пабмед Статья Google ученый

  • Даниэльссон Р., Шнурер А., Артурсон В., Бертилссон Дж.Метаногенная популяция и продукция CH 4 шведских молочных коров, получавших разное количество корма. Appl Environ Microbiol. 2012;78:6172–9.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Danielsson R. Производство метана у молочных коров, Влияние корма и микробиоты рубца; Acta universitatis agriculturae sueciae, 2016, докторская диссертация №. 2016. с. 45. Доступно на http://pub.epsilon.slu.se/13308/1/danielsson_r_160427.pdf.

    Google ученый

  • Kittelmann S, Pinares-Patino CS, Seedorf H, Kirk MR, Ganesh S, McEwan JC, et al. Два разных типа бактериальных сообществ связаны с низким уровнем выделения метана у овец. Плос Один. 2014;9(7):e103171.

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Shi WB, Moon CD, Leahy SC, Kang DW, Froula J, Kittelmann S, et al.Фенотипы выхода метана связаны с дифференциальной экспрессией генов в микробиоме рубца овец. Геном Res. 2014; 24:1517–25.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Wallace RJ, Rooke JA, Duthie CA, Hyslop JJ, Ross DW, McKain N, et al. Обилие архей в послеубойном пищеварительном тракте рубца может помочь предсказать выбросы метана от мясного скота. Научный доклад 2014; 4: 5892.

    КАС пабмед Статья Google ученый

  • Freitag TE, Toet S, Ineson P, Prosser JI.Связи между потоком метана и транскрипционной активностью метаногенов и окислителей метана в покровном торфяном болоте. FEMS Microbiol Ecol. 2010;73:157–65.

    КАС пабмед Google ученый

  • Коста К.С., Юн С.Х., Пан М., Берн Дж.А., Балига Н.С., Ли Дж.А. Влияние H 2 и формиата на урожайность и регуляцию метаногенеза у Methanococcus maripaludis . J Бактериол. 2013; 195:1456–62.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Wallace RJ, Rooke JA, McKain N, Duthie CA, Hyslop JJ, Ross DW, et al.Метагеном микробов рубца связан с высокой продукцией метана у крупного рогатого скота. Геномика BMC. 2015;16:839.

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Питта Д.В., Пинчак В.Е., Индугу Н., Веккиарелли Б., Синха Р., Фулфорд Д.Д. Метагеномный анализ микробиома рубца бычков с пенистым вздутием живота, вызванным пшеницей. Фронт микробиол. 2016;7:689.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Пей К.С., Мао С.И., Ченг Ю.Ф., Чжу В.Я.Разнообразие, изобилие и новые последовательности генов 16S рРНК метаногенов в жидкой, твердой и эпителиальной фракциях рубца крупного рогатого скота Jinnan. Животное. 2010;4:20–9.

    КАС пабмед Статья Google ученый

  • Мицумори М., Сан В. Контроль микробной ферментации рубца для уменьшения выбросов метана из рубца. Азиатско-австралийский J Anim Sci. 2008; 21: 144–54.

    КАС Статья Google ученый

  • Ньюболд С.Дж., Лассалас Б., Жуани Ж.-П.Важность метаногенов, связанных с реснитчатыми простейшими, в производстве метана в рубце in vitro. Lett Appl Microbiol. 1995; 21: 230–4.

    КАС пабмед Статья Google ученый

  • Фогельс Г.Д., Хоппе В.Ф., Штумм К.К. Ассоциация метаногенных бактерий с инфузориями рубца. Appl Environ Microbiol. 1980; 40: 608–12.

    КАС пабмед ПабМед Центральный Google ученый

  • Крумхольц Л.Р., Форсберг К.В., Вейра Д.М.Ассоциация метаногенных бактерий с простейшими рубца. Может J Microbiol. 1983; 29: 676–80.

    КАС пабмед Статья Google ученый

  • Беланче А., де ла Фуэнте Г., Ньюболд С.Дж. Изучение метаногенных сообществ, связанных с различными популяциями простейших рубца. FEMS Microbiol Ecol. 2014;90:663–77.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Коулман Г.С.Метаболизм простейших инфузорий рубца. FEMS Microbiol Rev. 1986; 39:321–44.

    КАС Статья Google ученый

  • Уильямс АГ, Коулман АГ. Простейшие рубца. Нью-Йорк: Спрингер; 1992.

    Книга Google ученый

  • Guyader J, Eugene M, Noziere P, Morgavi DP, Doreau M, Martin C. Влияние простейших рубца на выделение метана у жвачных животных: подход метаанализа.Животное. 2014; 8: 1816–25.

    КАС пабмед Статья Google ученый

  • Кройцер М., Кирхгесснер М., Мюллер Х. Влияние дефаунации на потерю энергии у мокриц, получающих различное количество целлюлозы и обычного или обработанного паром кукурузного крахмала. Anim Feed Sci Technol. 1986; 16: 233–41.

    Артикул Google ученый

  • Ранилья М.Дж., Жуани Дж.П., Моргави Д.П.Производство метана и деградация субстрата микробными сообществами рубца, содержащими отдельные виды простейших, in vitro. Lett Appl Microbiol. 2007; 45: 675–80.

    КАС пабмед Статья Google ученый

  • Берд С.Х., Хегарти Р.С., Вудгейт Р. Стойкое влияние дефаунизации на пищеварение и выработку метана у овец. Aust J Exp Agric Anim Prod Sci. 2008;48:152–5.

    КАС Статья Google ученый

  • Хегарти Р.С., Бёрд С.Х., Ванселоу Б.А., Вудгейт Р.Влияние отсутствия простейших с рождения или после отъема на рост и выработку метана у ягнят. Бр Дж Нутр. 2008; 100:1220–7.

    КАС пабмед Статья Google ученый

  • Sharp R, Ziemer CJ, Stern MD, Stahl DA. Таксон-специфические ассоциации между популяциями простейших и метаногенов в рубце и модельной системой рубца. FEMS Microbiol Ecol. 1998; 26:71–78.

    КАС Статья Google ученый

  • Ирбис К., Ушида К.Выявление метаногенов и протеобактерий из единичной клетки инфузорий рубца. J Gen Appl Microbiol. 2004;50:203–12.

    КАС пабмед Статья Google ученый

  • Regensbogenova M, McEwan NR, Javorsky P, Kisidayova S, Michalowski T, Newbold CJ, et al. Переоценка разнообразия метаногенов, связанных с инфузориями рубца. FEMS Microbiol Lett. 2004; 238:307–13.

    КАС пабмед Статья Google ученый

  • Tymensen LD, Beauchemin KA, McAllister TA.Структуры свободноживущих и связанных с простейшими метаногенных сообществ в рубце крупного рогатого скота различаются по данным сравнительного анализа генов 16S рРНК и mcrA. Микробиология. 2012; 158:1808–17.

    КАС пабмед Статья Google ученый

  • Токура М., Усида К., Миядзаки К., Кодзима Ю. Метаногены, связанные с инфузориями рубца. FEMS Microbiol Ecol. 1997; 22: 137–43.

    КАС Статья Google ученый

  • Ллойд Д., Уильямс А.Г., Аманн Р., Хейс А.Дж., Даррант Л., Ральфс М.Р.Внутриклеточные прокариоты в рубце реснитчатых простейших: обнаружение с помощью конфокальной лазерной сканирующей микроскопии после гибридизации in situ с флуоресцентными зондами 16S рРНК. Евр Дж Протистол. 1996; 32: 523–31.

    Артикул Google ученый

  • Jouany J-P, Zainas B, Senaud J, Groliere CA, Grain J, Thivend P. Роль инфузорий рубца простейших Polyplastron multivesiculatum , Entodinium sp. и Isotricha prostoma в переваривании смешанного рациона у овец.Репрод Нутр Дев. 1981; 21: 871–84.

    КАС пабмед Статья Google ученый

  • Беланче А., де ла Фуэнте Г., Ньюболд С.Дж. Влияние прогрессивной инокуляции овец без фауны голотричными простейшими и общей фауной на ферментацию рубца, микробное разнообразие и выбросы метана. FEMS Microbiol Ecol. 2015;91:fiu026. doi: 10.1093/femsec/fiu02613.

  • Иди Дж.М. Взаимоотношения между некоторыми простейшими инфузориями рубца.J Gen Microbiol. 1962; 29: 579–88.

    Артикул Google ученый

  • Kittelmann S, Pinares-Patino CS, Seedorf H, Kirk MR, McEwan JC, Janssen PH. Естественная изменчивость эмиссии метана у овец, питающихся гранулами из люцерны, не связана с типом сообщества инфузорий рубца. Микробиология. 2016; 162: 459–65.

    КАС пабмед Статья Google ученый

  • Штумм К.К., Гийзен Х.Дж., Фогельс Г.Д.Ассоциация метаногенных бактерий с инфузориями рубца овец. Бр Дж Нутр. 1982; 47: 95–9.

    КАС пабмед Статья Google ученый

  • Стюарт С.С., Флинт Х.Дж., Брайант, член парламента. Бактерии рубца. В: Hobson PN, Stewart CS, редакторы. Микробная экосистема рубца. Лондон: Чепмен и Холл; 1997. с. 10–72.

    Глава Google ученый

  • Denman SE, Martinez FG, Shinkai T, Mitsumori M, McSweeney CS.Метагеномный анализ микробного сообщества рубца после ингибирования образования метана галогенированным аналогом метана. Фронт микробиол. 2015;6:1087.

    ПабМед ПабМед Центральный Статья Google ученый

  • Поуп П.Б., Смит В., Денман С.Е., Триндж С.Г., Барри К., Хугенхольц П. и др. Изоляция Succinivibrionaceae, причастных к низким выбросам метана от таммарских валлаби. Наука. 2011; 333: 646–8.

    КАС пабмед Статья Google ученый

  • Росс Э.М., Моат П.Дж., Маретт Л., Кокс Б.Г., Хейс Б.Дж.Изучение влияния двух диет, снижающих содержание метана, на микробиом рубца с использованием массивного параллельного секвенирования. Дж. Молочная наука. 2013;96:6030–46.

    КАС пабмед Статья Google ученый

  • Сокол Х., Пиньер Б., Уоттерлот Л., Лахдари О., Бермудес-Умаран Л.Г., Гратаду Дж.Дж. и др. Faecalibacterium prausnitzii представляет собой противовоспалительную комменсальную бактерию, идентифицированную при анализе микробиоты кишечника пациентов с болезнью Крона.Proc Natl Acad Sci. 2008; 105:16731–6.

  • Gruninger RJ, Puniya AK, Callaghan TM, Edwards JE, Youssef N, Dagar SS, et al. Анаэробные грибы (тип Neocallimastigomycota): достижения в понимании их таксономии, жизненного цикла, экологии, роли и биотехнологического потенциала. FEMS Microbiol Ecol. 2014; 90:1–17.

    КАС пабмед Статья Google ученый

  • Koetschan C, Kittelmann S, Lu J, Al-Halbouni D, Jarvis GN, Müller T, et al.Анализ вторичной структуры внутреннего расшифрованного спейсера 1 обнаруживает общее ядро ​​для всех анаэробных грибов (Neocallimastigomycota). ПЛОС Один. 2014;9:e91928.

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Bauchop T. Анаэробные грибы в переваривании клетчатки рубца. Сельскохозяйственная среда. 1981; 6: 339–48.

    Артикул Google ученый

  • Тауэр Р.К., Кастер А.К., Зеедорф Х., Бакел В., Хеддерих Р.Метаногенные археи: экологически значимые различия в энергосбережении. Nature Rev Microbiol. 2008; 6: 579–91.

    КАС Статья Google ученый

  • Хангейт Р.Е., Смит В., Баухоп Т., Ю.И., Рабинович Дж.К. Формиат как промежуточное звено в ферментации бычьего рубца. J Бактериол. 1970; 102: 389–97.

    КАС пабмед ПабМед Центральный Google ученый

  • Баучоп Т., Маунтфорт Д.О.Ферментация целлюлозы рубцовым анаэробным грибком как в отсутствие, так и в присутствии метаногенов рубца. Appl Environ Microbiol. 1981; 42:1103–10.

    КАС пабмед ПабМед Центральный Google ученый

  • Волин М.Дж., Миллер Т.Л., Стюарт К.С. Микроб-микробные взаимодействия. В: Hobson PN, Stewart CS, редакторы. Микробная экосистема рубца. Лондон: Чепмен и Холл; 1997. с. 467–91.

    Глава Google ученый

  • Джоблин К.Н., Уильямс АГ.Влияние совместного культивирования хитридных грибов рубца с Methanobrevibacter smithii на деградацию стебля люцерны и активность внеклеточных грибковых ферментов. Lett Appl Microbiol. 1991; 12:121–4.

    КАС Статья Google ученый

  • Джоблин К.Н., Нейлор Дж.Э., Уильямс АГ. Влияние Methanobrevibacter smithii на ксиланолитическую активность анаэробных грибов рубца. Appl Environ Microbiol. 1990; 56: 2287–95.

    КАС пабмед ПабМед Центральный Google ученый

  • Марвин-Сиккема Ф.Д., Ричардсон А.Дж., Стюарт К.С., Готтшал Дж.К., Принс Р.А.Влияние водородопотребляющих бактерий на деградацию целлюлозы анаэробными грибами. Appl Environ Microbiol. 1990;56:3793–7.

    КАС пабмед ПабМед Центральный Google ученый

  • Демейер Д.И., Ван Невель С.Дж. Метаногенез, неотъемлемая часть ферментации углеводов и ее контроль. В: McDonald IW, Warner ACI, редакторы. Пищеварение и обмен веществ у жвачных. Армидейл: Издательство Университета Новой Англии; 1975 год.п. 366–82.

    Google ученый

  • Черкавский Ю.В. Продукция метана в рубце и ее значение. Диета Wld Rev Nutr. 1969; 11: 240–82.

    КАС Статья Google ученый

  • Taxis TM, Wolff S, Gregg SJ, Minton NO, Zhang C, Dai J и др. Игроки могут меняться, но игра остается: сетевой анализ микробиомов рубца показывает, что таксономические различия маскируют функциональное сходство.Нуклеиновые Кислоты Res. 2015;43:9600–12.

    КАС пабмед ПабМед Центральный Google ученый

  • Мартинес-Фернандес Г., Абесия Л., Арко А., Канталапьедра-Хихар Г., Мартин-Гарсия А.И., Молина-Алкайде Э. и др. Влияние этил-3-нитрооксипропионата и 3-нитрооксипропанола на ферментацию рубца, обилие микробов и выбросы метана у овец. Дж. Молочная наука. 2014;97:3790–9.

    КАС пабмед Статья Google ученый

  • Рейнольдс К.К., Хамфрис Д.Дж., Киртон П., Киндерманн М., Дюваль С., Стейнберг В.Влияние 3-нитрооксипропанола на выделение метана, пищеварение, энергетический и азотный баланс лактирующих молочных коров. Дж. Молочная наука. 2014;97:3777–89.

    КАС пабмед Статья Google ученый

  • Христов А.Н., О Дж., Джаллонго Ф., Фредерик Т.В., Харпер М.Т., Уикс Х.Л. и др. Ингибитор стойко снижал выделение кишечного метана у дойных коров, не оказывая отрицательного влияния на молочную продуктивность. Proc Natl Acad Sci. 2015; 112:10663–8.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Morvan B, Rieu-Lesme F, Fonty G, Gouet P. Взаимодействия in vitro между микроорганизмами, продуцирующими целлюлозу, H 2 и H 2 , использующими ацетогенные и сульфатредуцирующие бактерии. Анаэроб. 1996; 2: 175–80.

    КАС Статья Google ученый

  • Nkrumah JD, Okine EK, Mathison GW, Schmid K, Li C, Basarab JA, et al.Мур С.С. Взаимосвязь эффективности кормления на откормочных площадках, производительности и поведения при кормлении со скоростью метаболизма, производством метана и распределением энергии у мясного скота. J Anim Sci. 2006; 84: 145–53.

    КАС пабмед Статья Google ученый

  • Hegarty RS, Goopy JP, Herd RM, McCorkell B. Крупный рогатый скот, выбранный для более низкого остаточного потребления корма, имеет сниженное ежедневное производство метана. J Anim Sci. 2007; 85: 1479–86.

    КАС пабмед Статья Google ученый

  • Муро-Рейес А., Гутьеррес-Бануэлос Х., Диас-Гарсия Л.Х., Гутьеррес-Пина Ф.Дж., Эскарено-Санчес Л.М., Бануэлос-Валенсуэла Р. и др.Потенциальные экологические преимущества потребления остаточных кормов как стратегии снижения выбросов метана овцами. J Anim Veter Adv. 2011;10:1551–6.

    КАС Статья Google ученый

  • Карберри К.А., Кенни Д.А., Хан С., Маккейб М.С., Уотерс С.М. Влияние фенотипического остаточного потребления корма и содержания корма в рационе на микробное сообщество рубца мясного скота. Appl Environ Microbiol. 2012;78:4949–58.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Myer PR, Smith TPL, Wells JE, Kuehn LA, Freetly HC.Микробиом рубца бычков, различающихся по эффективности кормления. ПЛОС Один. 2015;10:e0129174. doi:10.1371/journal.pone.0129174.

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Шабат С.К., Сассон Г., Дорон-Файгенбойм А., Дурман Т., Яакоби С., Берг Миллер М.Е. и др. Конкретные механизмы, зависящие от микробиома, лежат в основе эффективности сбора энергии у жвачных животных. ISME J. 2016; 10: 2958–72. doi:10.1038/ismej.2016.62.

  • Департамент первичной промышленности Нового Южного Уэльса.Генетические технологии для сокращения выбросов метана австралийским мясным скотом. 2015. ISBN 978-1-74256-860-7.

    Google ученый

  • Веймер П.Дж., Стивенсон Д.М., Мантовани Х.К., Мэн СЛК. Специфичность бактериального сообщества рубца молочной коровы к хозяину после почти полного обмена содержимым рубца. Дж. Молочная наука. 2010;93:5902–12.

    КАС пабмед Статья Google ученый

  • Кинг Э.И., Смит Р.П., Сент-Пьер Б., Райт А.Д.Различия в метаногенных популяциях рубца лактирующих джерсейских и голштинских молочных коров при одинаковом режиме питания. Appl Environ Microbiol. 2011;77:5682–7.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Мальмутуге Н., Ли М., Фрайс П., Грибель П.Дж., Гуан Л.Л. Региональные и возрастные изменения в экспрессии генов Toll-подобных рецепторов и ключевых молекул антимикробной защиты во всем желудочно-кишечном тракте молочных телят.Вет Иммунол Иммунопатол. 2012; 146:18–26.

    КАС пабмед Статья Google ученый

  • Лю Дж., Бянь Г., Чжу В., Шэн-юн М.С. Кормление с высоким содержанием зерна вызывает сильные сдвиги в бактериальном сообществе эпителия рубца и экспрессии генов Toll-подобных рецепторов у коз. Фронт микробиол. 2015;6:167.

    ПабМед ПабМед Центральный Google ученый

  • Williams YJ, Rea SM, Popovski S, Pimm CL, Williams AJ, Toovey AF, et al.Реакция овец на вакцинацию энтодиниальными или смешанными протозойными антигенами рубца для уменьшения количества протозойных антигенов в рубце. Бр Дж Нутр. 2008;99:100–9.

    КАС пабмед Статья Google ученый

  • Williams YJ, Popovski S, Rea SM, Skillman LC, Toovey AF, Northwood KS, et al. Вакцина против метаногенов рубца может изменить состав популяций архей. Appl Environ Microbiol. 2009;75:1860–6.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Appuhamy JA, Wagner-Riddle C, Casper DP, France J, Kebreab E.Количественная оценка кинетики воды в организме и выхода воды с фекалиями и мочой у лактирующих молочных коров голштинской породы. Дж. Молочная наука. 2014;97:6177–95.

    КАС пабмед Статья Google ученый

  • Росс Э.М., Моат П.Дж., Маретт Л.С., Кокс Б.Г., Хейс Б. Метагеномные прогнозы: от микробиома до сложных фенотипов здоровья и окружающей среды у людей и крупного рогатого скота. ПЛОС Один. 2013;8:e73056.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Роэ Р., Дьюхерст Р.Дж., Дати К.А., Рук Дж.А., Маккейн Н., Росс Д.В. и др.Генетическая изменчивость хозяина крупного рогатого скота влияет на микробную выработку метана в рубце с лучшим критерием отбора для хозяев с низким уровнем выделения метана и эффективной конверсией корма на основе изобилия метагеномных генов. Генетика PLoS. 2016;12:e1005846.

    ПабМед ПабМед Центральный Статья КАС Google ученый

  • Ю. З. Т., Моррисон М. Улучшенное выделение ДНК сообщества, пригодное для ПЦР, из образцов пищеварительного тракта и фекалий. Биотехнологии. 2004; 36: 808–12.

    КАС пабмед Google ученый

  • Эдгар РЦ. MUSCLE: множественное выравнивание последовательностей с высокой точностью и высокой пропускной способностью. Нукл Кислоты Res. 2004; 32:1792–7.

    КАС пабмед ПабМед Центральный Статья Google ученый

  • Тамура К., Дадли Дж., Ней М., Кумар С. MEGA4: программное обеспечение для молекулярно-эволюционного генетического анализа (MEGA), версия 4.0. Мол Биол Эвол.2007; 24:1596–9.

    КАС пабмед Статья Google ученый

  • Влияние природного ловастатина на усвояемость корма, ферментацию рубца, микробиоту и выделение метана у коз в течение 12-недельного периода лечения

    Abstract

    Двадцать самцов зааненских коз были случайным образом распределены по четырем уровням приема ловастатина и использовались для определения оптимальной дозировки и устойчивости природного ловастатина в результате ферментации пальмоядрового жмыха (PKC) с Aspergillus terreus на энтеросолюбильном метане (CH ). 4 ) смягчение последствий.Влияние на микробиоту рубца, ферментацию рубца, усвояемость корма и здоровье животного определяли в течение трех периодов измерения (4, 8 и 12 недель), а накопление ловастатина в тканях определяли в конце эксперимента. Рационы содержали 50% рисовой соломы, 22,8% концентратов и 27,2% различных пропорций необработанной или обработанной PKC для достижения целевого суточного уровня потребления 0 (контроль), 2, 4 или 6 мг ловастатина/кг массы тела (МТ). Выбросы Enteric CH 4 на потребление сухого вещества (DMI) значительно снизились (P<0.05) и эквивалентно 11% и 20,4%, соответственно, для групп 2 и 4 мг/кг массы тела по сравнению с контролем. Никакого дальнейшего снижения эмиссии CH 4 после этого при более высоких добавках ловастатина. Ловастатин не оказывал влияния на усвояемость корма и незначительное влияние на микробиоту рубца и, в частности, не уменьшал популяции общих метаногенов и метанобактерий (отвечающих за производство CH 4 ). Точно так же ловастатин мало влиял на характеристики ферментации в рубце, за исключением того, что доля пропионата увеличивалась, что приводило к тенденции к снижению (P<0.08) в соотношении уксусная кислота: пропионат с увеличением дозы ловастатина. Это предполагает сдвиг в пути ферментации в рубце в пользу производства пропионата, который служит стоком H + , частично объясняя наблюдаемое снижение CH 4 . У животных не было отмечено неблагоприятных физиологических эффектов, за исключением того, что обработанный ПКС (содержащий ловастатин) был менее вкусным при самом высоком уровне включения. Остатки ловастатина были обнаружены в тканях коз, которым давали 6 мг ловастатина/кг МТ при температуре от 0 до 10 лет.01 до 0,03 мкг/г, что очень мало.

    Образец цитирования: Candyrine SCL, Mahadzir MF, Garba S, Jahromi MF, Ebrahimi M, Goh YM, et al. (2018) Влияние природного ловастатина на усвояемость корма, ферментацию рубца, микробиоту и выбросы метана у коз в течение 12-недельного периода лечения. ПЛОС ОДИН 13(7): e0199840. https://doi.org/10.1371/journal.pone.0199840

    Редактор: Арда Йилдирим, Университет Газиосманпаша, ТУРЦИЯ

    Поступила в редакцию: 14 сентября 2017 г.; Принято: 14 июня 2018 г.; Опубликовано: 5 июля 2018 г.

    Авторское право: © 2018 Candyrine et al.Это статья с открытым доступом, распространяемая в соответствии с условиями лицензии Creative Commons Attribution License, которая разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии указания автора и источника.

    Доступность данных: Все соответствующие данные содержатся в документе и в его файлах вспомогательной информации.

    Финансирование: Это исследование финансировалось правительством Новой Зеландии для поддержки целей Группы исследований животноводства Глобального исследовательского альянса сельскохозяйственных парниковых газов, Министерства первичной промышленности (6386600 для JBL) и Universiti Putra Malaysia (9300412 для JBL). ).Спонсоры не участвовали в разработке исследования, сборе и анализе данных, принятии решения о публикации или подготовке рукописи.

    Конкурирующие интересы: Авторы заявили об отсутствии конкурирующих интересов.

    Введение

    Снижение выбросов метана жвачными животными (CH 4 ) помогает защитить окружающую среду, поскольку кишечные выбросы CH 4 составляют примерно 17% от общего глобального антропогенного производства CH 4 [1].Сообщалось о многих подходах к смягчению последствий пищевого отравления CH 4 , таких как добавление в корм эфирных масел [2], низина [3] и конденсированных танинов [4], но маловероятно, что они будут приняты на уровне фермы, поскольку последствия часто носят временный характер. поскольку микробиота рубца может адаптироваться к изменениям в экосистеме рубца, создаваемым смягчающими агентами. Кроме того, некоторые смягчающие агенты CH 4 также ингибируют рост полезных микроорганизмов рубца, таких как бактерии, продуцирующие пептидазу, и целлюлозолитические бактерии [5–7], что приводит к снижению переваривания клетчатки в рубце.Совсем недавно были изучены подходы на основе ферментов и генов [8]. Сообщалось, что ловастатин, ингибитор 3-гидрокси-3-метил-глутарил-кофермента А-редуктазы (ГМГ-КоА-редуктазы), эффективно ингибирует активность ГМГ-КоА-редуктазы, которая необходима для биосинтеза клеточных мембран архей и, таким образом, избирательно подавление роста метаногенов без воздействия на другие микроорганизмы в микробном сообществе рубца [9–10]. Однако в вышеупомянутых исследованиях использовался коммерческий ловастатин [9], препарат, предназначенный для снижения уровня холестерина в крови у людей, который слишком дорог для применения в долгосрочных исследованиях на животных.Кроме того, одно исследование [10] было исследованием in vitro .

    Эффективность красного дрожжевого риса, традиционной китайской пищевой добавки для здоровья, полученной путем ферментации обычного риса с Monascus purpureus (содержащим ловастатин в форме монаколина К) в отношении CH 4 , смягчающего воздействие на крупный рогатый скот [11] и козы [12]. Несмотря на статистически значимое снижение выбросов г CH 4 на кг потребления сухого вещества у коз, которых кормили красным дрожжевым рисом (4.3 мг ловастатина/кг массы тела (МТ) составляли всего 13% по сравнению с контрольными животными. В то время как в случае крупного рогатого скота воздействие на выброс CH 4 было легким, но серьезные неблагоприятные воздействия на потребление DM и клинические проявления расстройств пищеварительной, мышечной и мочевыводящей систем были зарегистрированы при скармливании животным ловастатина в дозе 2,6 мг/кг массы тела. в день всего за четыре дня [11]. Мы сообщали, что ловастатин, полученный естественным образом с использованием рисовой соломы, инкубированной с Aspergillus terreus (130 мг ловастатина в 500 мг рисовой соломы в 30 мл забуференного раствора рубца), снижал продукцию in vitro CH 4 на 27% [10] и аналогичная скорость снижения выбросов CH 4 была получена у коз, которых кормили обработанной рисовой соломой при дозе 4 мг ловастатина/кг массы тела [13].Результаты вышеупомянутых исследований и исследования Klevenhusen et al. [14] с использованием овец предположили, что эффективная доза ловастатина для смягчения кишечных выбросов CH 4 составляет примерно 4 мг/кг массы тела для овец и коз, но ниже для крупного рогатого скота. На сегодняшний день все опубликованные исследования in vivo по использованию ловастатина для смягчения выбросов CH 4 у жвачных животных были краткосрочными (от нескольких дней до примерно четырех недель). Такие краткосрочные исследования не полностью учитывали потенциал микробиоты рубца, адаптирующийся к воздействию ловастатина с течением времени, а также возможные негативные последствия длительного потребления ловастатина для здоровья и благополучия животных.Таким образом, настоящее исследование было разработано для изучения реакции, включая потребление и усвояемость корма, ферментацию рубца, микробиоту и выбросы CH 4 , на пищевые добавки с увеличением доз природного ловастатина в течение 12-недельного периода с использованием коз в качестве модель животного. Пальмоядровый жмых (PKC), легкодоступный агропобочный продукт, который является обычным ингредиентом корма для жвачных животных, использовали в качестве субстрата при инкубации с Aspergillus terreus для получения необходимого ловастатина.

    Материалы и методы

    Приготовление пирога из ферментированных косточек пальмы

    Жмых косточек пальмы (побочный продукт экстракции косточкового пальмового масла), использованный для данного исследования, был приобретен на местном заводе по производству косточкового пальмового масла в штате Селангор, Малайзия. Ферментированный PKC был приготовлен с использованием процедуры ферментации в твердом состоянии (SSF), как описано Jahromi et al. [15] с некоторыми изменениями. Основными изменениями в протоколе ферментации были (i) ПКС (вместо рисовой соломы) использовался в качестве субстрата, (ii) количество субстрата было увеличено с 200 г рисовой соломы в 2-литровых колбах Эрленмейера (инкубация при 25 °C). в лабораторном инкубаторе) до 4 кг ПКС (инкубировали в лотках, установленных на стеллажах в помещении, оборудованном кондиционерами для контроля температуры окружающей среды от 22 до 25 °С) и (iii) исходное содержание влаги было увеличено с 50 до 55%.Другие факторы инкубации, включая инокулят ( Aspergillus terreus ATCC74135) и рН (7,0), остались такими же, как сообщалось ранее. PKC инкубировали в течение 10 дней, а собранные PKC сушили в сушильном шкафу с принудительной подачей воздуха при 60 °C, измельчали ​​через сито с размером ячеек 2 мм и хранили для последующего использования. Образцы ферментированного PKC анализировали на общий ловастатин и доли биоактивных гидроксикислотных и менее активных форм лактона с помощью ВЭЖХ [15]. Обработанный ПКС содержал в среднем 850 мг ловастатина/кг сухого вещества (СВ).

    Экспериментальный дизайн и содержание животных

    Экспериментальный протокол был одобрен Комитетом по уходу за животными и этике Университета Путра Малайзии (UPM/IACUC/AUP-R0087/2015). Двадцать интактных самцов зааненских коз (возраст 4–5 месяцев, средняя масса тела 26 ± 3,4 кг) были случайным образом распределены в равных количествах для четырех обработок [0 (контроль), 2 (низкая), 4 (средняя) или 6 (высокая) мг. ловастатина/кг массы тела, чтобы определить влияние увеличения потребления ловастатина в рационе на потребление корма и кажущуюся усвояемость во всем тракте, ферментацию рубца, микробиоту и выбросы CH 4 у коз.Козы содержались в индивидуальных загонах со свободным доступом к чистой питьевой воде и минеральным блокам. После двухнедельной адаптации в течение первого (4-недельного) периода измерений козам индивидуально предлагали ограниченный уровень кормления 650 г/день двумя равными порциями (08:00 и 20:00). Принятие ограниченного уровня кормления, определяемого как 90% от наименьшего потребления козами в течение двухнедельного периода адаптации, должно было гарантировать, что все козы будут потреблять предлагаемые им дневные рационы в течение всего эксперимента.Общий смешанный рацион, содержащий 50 % рисовой соломы, 22,8 % концентратов и 27,2 % различных пропорций необработанного или обработанного PKC (таблица 1), для достижения целевого суточного уровня потребления 0 (контроль), 2 (низкий), 4 (средний) или 6 (высокая) мг ловастатина/кг массы тела. Для второго (8-недельного) и третьего (12-недельного) измерений уровень кормления был увеличен до 700 г/день при сохранении тех же четырех целевых уровней ежедневного потребления ловастатина. Последнее было достигнуто за счет сохранения количества обработанного ПКС (носителя ловастатина) и соответствующего увеличения доли других ингредиентов.

    Сухой остаток, органическое вещество (ОВ), сырой протеин, кальций и фосфор в образцах кормов определяли в соответствии с AOAC [16], валовую энергию определяли бомбовым калориметром, нейтрально-детергентную клетчатку (NDF) и кислотно-детергентную клетчатку (ADF) определяли по Van Soest et al. [17] (табл. 2).

    Испытание на усвояемость и измерение газообразного метана

    Исследовательский центр для этого исследования имеет пять дыхательных камер для измерения выбросов CH 4 .Выбросы метана у всех 20 коз в четырех экспериментальных группах измерялись в течение трех периодов; на 4, 8 и 12 неделе пробного кормления. Каждое измерение CH 4 состояло из 5 коз, случайно выбранных из каждой экспериментальной группы, и проводилось в течение двух последовательных дней, что в сумме составило 8 дней за период кормления (5 коз за два дня), чтобы завершить измерение для 20 животных. Перед измерениями CH 4 животных переводили в метаболические клетки для пятидневного испытания кажущейся усвояемости всего тракта с использованием процедуры полного сбора фекалий [18].После того, как был определен ежедневный общий выход фекалий, 10% дневных фекалий от каждого животного были отобраны и сохранены, а затем объединены животными в конце 5-дневного испытания на усвояемость, высушены в сушильном шкафу с принудительной вентиляцией при 60°C в течение 48 часов. часов и перетирают через сито с отверстиями 2 мм перед дальнейшим анализом.

    После испытания на усвояемость коз случайным образом распределяли по дыхательным камерам за день до начала измерения CH 4 . Все козы ранее (в период адаптации) адаптировались к камерам до проведения замеров газа.

    Пять дыхательных камер открытого цикла были сконструированы по проекту, реализованному в AgResearch, Новая Зеландия [19]. Внутренний объем каждой камеры составляет приблизительно 2,0 м 3 и состоит из прозрачного поликарбонатного корпуса, прикрепленного к раме из оцинкованного железа. Вся передняя и задняя часть камер — двери. При открытии передняя дверь дает оператору свободный доступ к кормушкам и поилкам, которые прикреплены к клетке, удерживающей животное внутри камеры.Задняя дверь позволяет перемещать животных в камеру и из нее, а также удалять и очищать мочу и фекалии, собранные в поддоне под полом клетки. Камера имеет выпускную трубу (верхний задний конец камеры), всасывающую воздух в камеру через небольшое впускное отверстие в верхней передней части камеры.

    Камеры были расположены в ряд, в хорошо проветриваемом экспериментальном помещении, оборудованном кондиционерами для поддержания комнатной температуры от 22 до 25 °C.Скорость восстановления для каждой камеры определяли перед каждым периодом измерения. Из-за небольшого размера коз скорость потока воздуха на выходе была установлена ​​на уровне ок. 200 л/мин (измерено с помощью анемометра (SDL300 Extech Instruments, США). Измерение газа началось в 08:00, концентрации CH 4 и углекислого газа (CO 2 ) в выходящем воздухе определялись с помощью переносного газового анализатор (Horiba PG-300, Япония) и усредненные значения (среднее 20 отсчетов при одном отсчете в три секунды) регистрировали ежечасно в течение двенадцати часов в сутки (08:00–20:00) в течение двух дней подряд.Двухдневные измерения должны учитывать ежедневные колебания выбросов метана (если таковые имеются), а среднесуточные выбросы метана рассчитывались на основе двухдневных значений выбросов метана. При этом температура и давление окружающей среды в камерах также регистрировались с помощью регистратора данных (SD700 Extech Instruments, США).

    В течение первых двух периодов (4- и 8-неделя), на следующий день после завершения измерения газов, образец содержимого рубца коз брали через четыре часа после утреннего кормления с помощью желудочного зонда.Для окончательного измерения (12 недель) образец содержимого рубца брали непосредственно из рубца коз, когда животных забивали. Затем содержимое рубца каждого животного осторожно отжимали через четыре слоя марли, отделяя кормовой материал от содержимого рубца, для получения рубцовой жидкости [20]. Немедленно определяли pH жидкости рубца и разделяли жидкость на две порции; один хранился при -80 °C в ожидании экстракции ДНК для анализа микробного сообщества рубца, а другой хранился в 25% метафосфорной кислоте (w:v) и хранился при -20 °C для анализа летучих жирных кислот (VFA).

    За здоровьем и самочувствием животных, в частности за потреблением корма и проявлениями пищеварительных расстройств, тщательно следили посредством визуальных наблюдений ежедневно на протяжении всего эксперимента лечащим ветеринаром, участвовавшим в исследовании. По окончании испытания кормления (12 недель) коз забили в соответствии с халяльными (предписанными мусульманским законодательством) стандартными процедурами (MS 1500: 2009 Департамента стандартов Малайзии, 2009). Перед забоем через яремную вену от каждого животного брали примерно 10 мл образцов крови для гематологического и биохимического анализов.Также было собрано примерно по 20 г мышечной ткани ( Длиннейшая мышца спины ) и образцов органов (мозг, печень и почки). Образцы хранили на льду во время отбора проб и сразу после отбора переносили и хранили при -20°C до последующего использования для определения остатков ловастатина в образцах.

    Исследование остатков ловастатина

    Для определения остатков ловастатина в тканях мышц и органов (почки, печень, мозг) по 1 г образцов растирали до гомогенности с 5 мл метанола.Экстракты затем сушили при 70°C в течение 10 часов перед ресуспендированием в 60% ацетонитриле и центрифугировали при 20000 g в течение 20 минут. Верхний слой экстракта анализировали на остатки ловастатина с помощью ВЭЖХ по методике, описанной ранее [15]. Поскольку концентрация остатков ловастатина во всех образцах была ниже определяемого уровня (1 мкг) с помощью ВЭЖХ, один образец каждой ткани из группы с самым высоким уровнем лечения ловастатином (6 мг/кг массы тела) был отправлен для дальнейшего анализа с использованием тандемной жидкостной хроматографии с ловушкой. Спектрометр (LCMS/MS) (AB Sciex 3200Q) (Торонто, Канада) в сочетании с системой сверхвысокоэффективной жидкостной хроматографии Perkin Elmer Flexar FX15 (UHPLC) (Массачусетс, США).ЖХ-МС была оснащена колонкой Synergi Fusion RP (Phenomenex, 100 мм x 2,0 мм x 4 мкМ). Подвижные фазы представляли собой воду с 0,1% муравьиной кислоты (подвижная фаза А) и ацетонитрил с 0,1% муравьиной кислоты (подвижная фаза В) при общем времени работы 8 минут. Хроматографию проводили с помощью метода монитора множественных реакций (MRM). Программа градиентного прогона была установлена ​​на уровне от 10% до 90% подвижной фазы В от 0,01 мин до 4 мин и выдерживалась в течение 1 мин, после чего возвращались к 10% подвижной фазы В и повторно уравновешивались в течение 3 мин.

    Количественное определение летучих жирных кислот рубца

    Образцы рубцовой жидкости, собранные, как описано ранее, центрифугировали при 10000 x g в течение 20 минут, а супернатанты собирали для анализа.Уксусную, пропионовую и масляную кислоты определяли с помощью газожидкостной хроматографии с использованием капиллярной колонки Quadrex 007 Series (Quadrex Corporation, New Haven, CT 06525 USA) из плавленого кварца со связанной фазой (15 м, внутренний диаметр 0,32 мм, толщина пленки 0,25 мкм) в газожидкостный хроматограф Agilent 7890A (Agilent Technologies, Пало-Альто, Калифорния, США), оснащенный пламенно-ионизационным детектором (ПИД). Температуру инжектора поддерживали на уровне 220 o 900 10 C, а температуру детектора поддерживали на уровне 230 o 900 10 C.Температуру колонки сначала устанавливали от 70 o 900 10°С до 150 o 900 10 С и запрограммировали ее повышение со скоростью 7 o 900 10 С/мин для достижения оптимального разделения пиков. Стандартом, используемым для определения ЛЖК, была 4-метил-N-валериановая кислота (Sigma, Сент-Луис, Миссури, США).

    Анализ микробных сообществ рубца

    Выделение геномной ДНК.

    Образцы рубцовой жидкости для микробного анализа центрифугировали при 10 000 x g в течение 10 минут, а ДНК экстрагировали из осадка с помощью набора QIAamp DNA Stool Mini Kit (Qiagen Inc., Валенсия, Калифорния) в соответствии с протоколами производителя.

    Глубокое секвенирование.

    Для более полного исследования микробных сообществ рубца ДНК, выделенная из каждого образца, была отправлена ​​в Macrogen Inc. (Корея) для построения библиотеки и секвенирования на платформе MiSeq (Illumina). Глубокий метагеномный анализ последовательности проводили с использованием праймеров 341F (CCTACGGGAGGCAGCAG) и 806R (GGACTACTAGGGTTTCTAAT), нацеленных на участки V3 и V4 гена 16S рРНК архей и бактерий [21].Последовательности были обработаны, кластеризованы и таксономически классифицированы с использованием программного пакета QIIME (Quantitative Insights Into Microbial Ecology) [22]. Во-первых, чтения парных концов были объединены с использованием FLASH (Fast Length Adjustment of Short reads [23]. Кластеризация и определение OTU (Operational Taxonomic Units) были выполнены с использованием CD-HIT-OTU с отсечением идентичности 97% [24] Таксономическое распределение было выполнено с использованием основной базы данных Greengenes (версия 13.8).Затем OTU были разрежены до наименьшего количества последовательностей (n = 6641), чтобы обеспечить одинаковую глубину анализа последовательностей.

    Отбор проб (охват Гуда), кривая разрежения и альфа-разнообразие (индексы разнообразия Шеннона и Симпсона, Chao1) были выполнены для получения разнообразия сообщества. Анализ бета-разнообразия использовался для сравнения разнообразия между различными методами лечения в разные периоды выборки. Это включает в себя рассчитанное расстояние Брея-Кертиса и взвешенное расстояние Unifrac, нанесенное на график с помощью анализа основных координат (PCoA) для визуализации несходства микробных сообществ при различных обработках в разные периоды.Необработанные последовательности были депонированы в базе данных NCBI (номер доступа к проекту: SRP113663).

    ПЦР в реальном времени.

    Экстрагированная ДНК была также подвергнута количественной полимеразной цепной реакции в реальном времени (кПЦР) для количественного определения популяции выбранных микробов. Используемые праймеры показаны в таблице 3.

    Количественную ПЦР в реальном времени проводили для выделенной ДНК на приборе BioRad CFX96 Touch (BioRad, США). Реакции кПЦР проводили в общем объеме 25 мкл с использованием Maxima SYBR Green Mastermix (Thermo Scientific, США).Реакции включали 12,5 мкл SYBR Green Supermix, по 1 мкл каждого обратного праймера и прямого праймера, 2 мкл выделенных образцов ДНК и 8,5 мкл не содержащей ДНКазы H 2 O. Условия количественной ПЦР применяли ко всем образцам, состоящим из первоначальной инкубации при 94°С в течение 5 мин, затем 40 циклов денатурации при 94°С в течение 20 с, отжига в течение 30 с и удлинения при 72°С в течение 20 с. Температуры отжига для праймеров тотальных бактерий, тотальных грибов, тотальных простейших, тотальных метаногенов, Butyrivibrio fibrisolvens , Ruminococcus albus и Fibrobacter succinogenes составляли 55°C, а для Ruminococcus flavefaciens и видов Methanobacteriales были при 55°C. [31].

    Статистический анализ

    Поскольку измерения проводились на одной и той же экспериментальной единице (козе), был рассмотрен повторный анализ ANOVA с одним экспериментальным фактором (рационы) и одним повторяющимся фактором (периоды). Животные рассматривались как подлинные репликации, а модели линейных смешанных эффектов использовались как с «диетами», так и с «периодами» в качестве фиксированных эффектов и «животными» в качестве случайных эффектов для захвата соответствующей структуры для дисперсионного анализа. Рассматривалась полная факторная модель с двумя фиксированными эффектами.Попарные сравнения средних между обработками проводились с использованием критерия наименьшей значимой разницы Фишера. Значения P <0,05 считались статистически значимыми, значения P ≥0,05 и <0,1 считались тенденцией. Все анализы проводились с использованием программного обеспечения R версии 3.3.3 (R Core Team (2017)) (пакет nlme с функцией lme для проведения линейного моделирования смешанных эффектов). Поскольку гематологический и биохимический анализы крови были проведены только в конце исследования (12-недельный период), два вышеуказанных набора данных были проанализированы как однофакторный дисперсионный анализ.Для метагеномного анализа все назначенные таксономии были проанализированы с использованием программного обеспечения «Статистический анализ метагеномных профилей» (STAMP) [32], применяя двусторонний t-критерий Уэлча для сравнения между различными группами выборок и получая P-значения для статистического анализа в течение каждого периода. .

    Результаты

    Потребление сухого вещества и переваримость

    Ферментация PKC для получения ловастатина для испытания с кормлением в этом исследовании соответствовала протоколу, описанному Jahromi et al.[15]. Содержание ловастатина в ферментированной ПКС различалось в разных партиях. Однако среднее содержание ловастатина в обработанной (ферментированной) РКС, использованной для этого эксперимента, составляло 850 мг ловастатина/кг СВ (в диапазоне 800–900 мг/кг), что содержало 73,5% активной Н-формы (в диапазоне 56–91%), в то время как остальные 26,5% находились в менее активной форме лактона. Обработанные PKC из разных партий объединяли вместе для каждого периода кормления, и их фактическую концентрацию ловастатина использовали для расчета различных пропорций обработанных и необработанных PKC для достижения целевых уровней ловастатина для различных экспериментальных групп.

    В целом потребление сухого вещества (DMI) снижалось с увеличением уровня ловастатина в рационе, но только DMI для лечения 6 мг/кг МТ было значительно ниже, чем в контроле (Таблица 4). Это наблюдение было последовательным в течение трех периодов измерения. Кажущаяся усвояемость DM во всем тракте (DMD) не зависела от уровня ловастатина и составляла в среднем 57,2% для контрольной и 56,3% для экспериментальных групп. Период не влиял на DMI и DMD, и не было влияния диеты x периода на DMI и DMD.

    Таблица 4. Влияние повышения уровня ловастатина на потребление сухого вещества (DMI, г/день), кажущуюся усвояемость сухого вещества всего тракта (DMD, %) и потребление перевариваемого сухого вещества (DDMI, г/день) у коз.

    https://doi.org/10.1371/journal.pone.0199840.t004

    Выбросы метана

    Среднее значение выбросов CH 4 составляло 19,31 л/день для коз в контрольной группе (0 ловастатина) и неуклонно снижалось до 17,81, 14,95 и 11,80 л/день, соответственно, для низких, средних и высоких обработок (таблица 5).Не было существенной разницы в эмиссии CH 4 между группой с низким уровнем обработки и контролем. С другой стороны, выбросы CH 4 в группах обработки Medium и High были ниже, чем в контрольной группе, со средним снижением на 22,6% и 38,9% соответственно. Когда снижение CH 4 было скорректировано на основе DMI на кг (зарегистрированного в течение двухдневного периода измерения газа), выброс CH 4 составил 36,98 л/кг DMI для контрольной группы и уменьшился (P<0.05) до 32,72 (снижение на 7,8%), 29,43 (снижение на 20,4%) и 29,21 л/кг DMI (снижение на 21,0%), соответственно, для групп с низкой, средней и высокой степенью обработки. На эмиссию CH 4 (л/день) оказывалось влияние периода, при этом 8- и 12-недельные измерения были выше (P<0,001), чем первое (4-недельное) измерение. Однако никакого эффекта периода не было обнаружено, когда эмиссия CH 4 была скорректирована на основе DMI.

    Микробные популяции

    В общей сложности было получено 752 869 высококачественных прочтений последовательностей из рубца 20 коз, отобранных в три разных периода (4 недели, 8 недель и 12 недель).Эти последовательности были отнесены к 13 103 OTU архей и бактерий на основе порога сходства 97%. Чтобы гарантировать, что для последующих анализов использовалась одинаковая глубина последовательности, порядковый номер был нормализован до наименьшего количества последовательности на образец (n = 6641). Индексы охвата Гуда, приближающиеся к 100 %, указывают на то, что библиотеки для секвенирования 16S рРНК способны представлять большинство OTU, присутствующих во всех секвенированных образцах.

    На основании таксономического отнесения к базе данных Greengenes 21 тип был идентифицирован с Bacteroidetes (64.76 ± 7,90%) и Firmicutes (28,20 ± 7,51%) в качестве доминирующих типов во всех возрастных группах в рубце коз (рис. S1).

    Общее бактериальное разнообразие, измеренное с использованием индексов Chao1, Шеннона и Симпсона (таблица 6), не показало заметных различий в видовом богатстве при повышенном уровне ловастатина и периодическом эффекте. Бета-разнообразие рассчитывали с использованием расстояний Брея-Кертиса и визуализировали с помощью PCoA (рис. 1 и S2). В целом, не наблюдалось четких паттернов кластеризации в зависимости от периода (рис. S2).Однако сообщества 4-й и 8-й недель были более тесно связаны друг с другом, чем с сообществом 12-й недели. Кроме того, в первый период наблюдалась группировка микробиоты рубца, зависящая от лечения, в то время как в контрольных группах наблюдались различия, что свидетельствует о более разнообразной флоре (рис. 1).

    Рис. 1. Анализ главных координат (PCoA) таксономической классификации до уровня рода с использованием расстояния Брея-Кертиса.

    A) 4-недельный период, B) 8-недельный период и C) 12-недельный период коз, которых кормили разными уровнями ловастатина.

    https://doi.org/10.1371/journal.pone.0199840.g001

    Влияние различных доз ловастатина на популяцию Archaea и других выбранных микробов, количественно оцененное с помощью количественной ПЦР, показано в таблице 7. Удивительно, но результаты это исследование показало, что ловастатин оказывает незначительное влияние на микробные популяции рубца. Простейшие были уменьшены в группе с низким уровнем обработки, но были одинаковыми в группах со средним и высоким уровнем обработки. Ruminococus flavefaciens уменьшался с повышением уровня ловастатина, и группа лечения High значительно отличалась от контроля.Ни на одну из других исследованных бактерий не повлияло повышение уровня ловастатина. Метаногены и метанобактерии имели тенденцию к снижению только в группах лечения по сравнению с контрольной группой.

    Со временем общее количество бактерий увеличилось, как и Fibrobacter succinogenes и Butyrivibrio fibrisolvens . Наряду с бактериями увеличилось количество простейших, а также общее количество метаногенов и метанобактерий с 4 до 12 недель.

    Профиль летучих жирных кислот и pH

    Влияние различных доз ловастатина на рН и содержание ЛЖК в рубцовой жидкости представлено в Таблице 8.Не было существенной разницы в концентрации ацетата, однако повышенная концентрация пропионата наблюдалась с повышением уровня дозировки ловастатина, особенно для средних и высоких групп лечения, что приводило к более низкому соотношению A/P по сравнению с контролем. Общее производство ЛЖК увеличивалось с увеличением дозы ловастатина, но только в группе с низким содержанием ловастатина оно было значительно выше, чем в контроле. С другой стороны, концентрация изобутирата в группе с высоким содержанием ловастатина была ниже, чем в контрольной и других группах лечения.Для большинства измеренных ЛЖК наблюдался эффект периода. Эффекты несовместимы с ацетатом и пропионатом, и, в частности, общее количество ЛЖК увеличивалось с течением времени измерения (например, 4-, 8- и 12-недельные периоды), в то время как другие (изопропионат и изобутират) уменьшались.

    Параметры крови

    Данные биохимического и гематологического анализов крови являются полезными индикаторами любого физиологического стресса у животных. Результаты не показали существенных различий по большинству измеренных параметров, за исключением среднего объема эритроцитов (MCV), эозинофилов, базофилов, а также общего холестерина, липопротеидов высокой плотности (ЛПВП) и липопротеинов низкой плотности (ЛПНП) (табл. 9). ).MCV был самым низким в группе с низким содержанием по сравнению с другими видами лечения, в то время как количество эозинофилов и базофилов было ниже во всех группах, получавших ловастатин, по сравнению с контролем. Добавка ловастатина, в том числе низкое лечение, значительно снизила концентрацию общего холестерина, ЛПНП и ЛПВП (P<0,001) по сравнению с контрольной группой.

    Остатки в тканях

    Концентрации остатка ловастатина во всех тканях (молочная мышца, головной мозг, печень и почки) для всех видов лечения были ниже уровней, определяемых методом ВЭЖХ.Кроме того, результаты анализа LCMS для образцов каждого типа тканей самого высокого уровня (т. е. 6 мг/кг массы тела) также показали очень низкие концентрации ловастатина от 0,01 до 0,03 мкг/г ткани.

    Обсуждение

    Кишечное выделение CH 4 является естественным явлением, происходящим во время анаэробного пищеварения у животных, особенно у жвачных животных. Несмотря на то, что за последние два-три десятилетия были предприняты значительные усилия в области исследований с целью сокращения выбросов этого мощного парникового газа от жвачных животных, ни один из методов смягчения последствий CH 4 не получил широкого признания среди фермеров.Это связано с тем, что эффект был либо краткосрочным, либо смягчающие агенты, используемые для подавления активности метаногенов, также неблагоприятно повлияли на другие полезные бактерии в экосистеме рубца и, в конечном итоге, на продуктивность животных. Вышеуказанные недостатки привели к поиску специфических соединений, таких как статины, класс ингибиторов ГМГ-КоА-редуктазы, которые специфически препятствуют биосинтезу клеточных мембран архей и, таким образом, избирательно подавляют рост метаногенов. Однако при использовании этих соединений все еще остается несколько неясных вопросов, в том числе: оптимальная дозировка и долгосрочные эффекты статинов для эффективного снижения кишечной эмиссии CH 4 ; их влияние на здоровье и благополучие животных-хозяев; возможное накопление статинов в съедобных тканях и молоке животных.

    Результаты нашего 12-недельного исследования не показали неблагоприятных физиологических или поведенческих эффектов, за исключением того, что некоторые животные в группах с более высокой дозировкой (в частности, 6 мг/кг массы тела) не потребляли всего предложенного им корма. Наши результаты также показали, что низкое потребление корма животными, получавшими повышенное количество ловастатина, сохранялось на протяжении всего эксперимента. Неясно, был ли более низкий DMI при лечении ловастатином с более высоким содержанием из-за плохой вкусовой привлекательности ферментированного PKC или прямого воздействия ловастатина на экосистему рубца и хозяина.Тот факт, что добавление ловастатина не оказало существенного влияния на общую микробную популяцию (включая метаногены) в рубце (таблица 7) и не повлияло на кажущиеся коэффициенты переваримости сухого вещества во всем тракте среди обработок, по-видимому, предполагает, что вкусовые качества корма могут быть главный фактор, влияющий на низкий DMI. Однако приведенное выше предположение требует дальнейшего изучения.

    Выброс

    Enteric CH 4 зависит от нескольких факторов, включая количество и качество корма, и было показано, что он сильно коррелирует с потреблением DM [33–35].DMI коз в группе высокой обработки был ниже (P<0,05), чем в контрольной, низкой и средней группах. Таким образом, выбросы CH 4 при разных обработках также сравнивали на основе DMI (L CH 4 /кг DMI), чтобы исключить влияние дифференциального DMI между обработками на выбросы CH 4 . Результаты нашего исследования показали, что ловастатин в низкой дозировке (2 мг ловастатина/кг МТ) снижает выброс CH 4 на кг DMI на 11,4%, в то время как снижение увеличивается примерно до 21% при средних и высоких дозах (4 и 6). мг/кг массы тела соответственно) по сравнению с контролем.Поскольку наблюдалось снижение содержания NDF в рационах, обработанных ловастатином, по сравнению с контролем (Таблица 2), более низкая эмиссия CH 4 у коз, получавших ловастатин (в частности, в группах средней и высокой обработки), также могла быть частично эффект более низкого потребления NDF. Мы не исключаем эту возможность полностью, но утверждаем, что потребление NDF не является основным фактором, влияющим на выброс CH 4 в этом исследовании. Это связано с тем, что потребление NDF козами в группе высокого лечения составляло 18.на 86 % ниже, чем у коз в группе, получавшей среду (182,73 против 225,19 г/день), но не было дальнейшего снижения выделения CH 4 у коз, получавших высокий уровень дозировки (более низкое потребление NDF), по сравнению с кормили в группе среднего лечения (более высокое потребление NDF). Кроме того, результаты регрессионного анализа влияния уровня кормления и качества рациона на эмиссию CH 4 у овец показали, что самая сильная связь была обнаружена между DMI и эмиссией CH 4 , где только DMI объяснял 91% вариации в CH 4 эмиссия.Включение переменной качества корма (например, липидов или NDF) в зависимость лишь незначительно улучшило уравнение прогноза, при этом r 2 увеличилось с 0,91 до 0,94 [36].

    Результаты этого исследования показывают, что оптимальная доза природного ловастатина для смягчения кишечной эмиссии CH 4 у коз будет составлять около 4 мг/кг массы тела. Дальнейшего снижения выбросов метана при дозировке выше 4 мг/кг МТ не наблюдалось. Предлагаемая оптимальная дозировка из настоящего исследования близка к предложенной 4.34 мг ловастатина/кг массы тела из красного дрожжевого риса, использованного Wang et al. [12] у коз. Однако авторы получили снижение эмиссии CH 4 только на 13%, в то время как снижение, достигнутое с ловастатином природного происхождения в нашем эксперименте, составило 20,4%. Моргави и др. [37] добавляли овцам красный дрожжевой рис (2,26 мг ловастатина на кг массы тела) в течение 2 недель и сообщали о 30-процентном снижении кишечной эмиссии CH 4 уже на третий день кормления. Однако эти различия в выбросах метана могут быть связаны с влиянием рациона питания и/или различиями в микробном сообществе рубца.С другой стороны, скармливание ферментированного риса, содержащего 2,2 мг ловастатина/кг массы тела, даже всего в течение четырех дней приводило к снижению потребления корма и критическим клиническим проявлениям расстройств пищеварительной, мышечной и мочевыводящей систем у крупного рогатого скота [11]. Данные из литературы и текущего исследования показывают, что крупный рогатый скот менее толерантен к ловастатину по сравнению с овцами и козами, в то время как вариабельность скорости смягчения воздействия CH 4 в пределах одного вида может быть связана с различиями в концентрациях активной формы гидроксикислоты в соединение, как показано Faseleh Jahromi et al.[38]. Концентрация активной гидроксикислоты ловастатина в красном дрожжевом рисе, использованном Wang et al. [12] составил 56%, в то время как в этом исследовании он составил в среднем 73,5%. Важно отметить, что влияние ловастатина на выброс CH 4 у коз в этом исследовании было одинаковым в течение всех трех периодов измерения, что позволяет предположить, что добавление ловастатина в пищу для смягчения выброса CH 4 может быть эффективным в течение как минимум 12 недель.

    На основании метагеномного исследования ловастатин не влиял на микробное разнообразие или богатство рубца.В этом исследовании Bacteroidetes и Firmicutes были доминирующими типами, обнаруженными в рубцовой жидкости коз, что соответствует результатам Wang et al. [21] и Хендерсон и соавт. [39]. Будучи ингибитором ГМГ-КоА-редуктазы, ловастатин должен ингибировать биосинтез клеточных мембран архей и подавлять рост метаногенов, о чем сообщалось в ряде исследований [10, 12, 40]. Удивительно, но наши результаты количественной ПЦР не совпали с вышеизложенным. В нашем исследовании общее количество метаногенов и видов Methanobacteriales (известно, что они ответственны за большую часть продукции CH 4 ) в группах лечения ловастатином, как правило, были ниже, но не были статистически значимыми по сравнению с контролем (P>0.05). Хотя исследование Wang et al. [12] сообщили о более низком сокращении CH 4 по сравнению с настоящим исследованием (13 против 20,4%), они наблюдали значительное снижение доли Methanobrevibacter . Однако численность некоторых архей осталась неизменной или даже увеличилась (например, Methanomirobium ) при добавлении ловастатина. Вышеупомянутые авторы предположили, что, возможно, некоторые, но не все археи нуждаются в HMG-CoA-редуктазе в своем росте и пролиферации.Наше исследование показало, что общее количество метаногенов и метанобактерий, а также некоторых других (общее количество простейших, общее количество бактерий, Fibrobacter succinogenes и Butyrivibrio fibrisolvens ) увеличивалось со временем, особенно при 12-недельном измерении по сравнению с 4-недельным измерением (P< 0,01). Это увеличение может быть связано с различиями в протоколах отбора проб жидкости рубца (пероральный желудочный зонд в 4- и 8-недельном возрасте по сравнению с прямым забором из рубца забитых животных для 12-недельных образцов).

    Влияние добавок ловастатина на характеристики ферментации в рубце также изучалось в этом исследовании, чтобы лучше понять влияние ловастатина на процесс кишечной эмиссии CH 4 . На общее производство ЛЖК не влияло добавление ловастатина, что согласуется с тем фактом, что ловастатин мало влиял на микробные популяции рубца, а также не влиял на усвояемость рациона. Влияние ловастатина на профили ЛЖК было непоследовательным, за исключением того, что увеличение дозы ловастатина (средние и высокие группы лечения) увеличивало долю пропионата по сравнению с контролем (P<0,0.01), в то время как доля ацетата не отличалась (P>0,5) между обработками. Положительный эффект ловастатина на выработку пропионата в этом исследовании свидетельствует о том, что добавление ловастатина в пищу изменяет путь ферментации, способствуя выработке пропионата в рубце, который служил альтернативным стоком H 2 , конкурируя с метаногенами за выработку CH 4 . Кроме того, снижение количества Ruminococcus , наблюдаемое в этом исследовании, должно было привести к уменьшению производства ацетата и, следовательно, снижению производства H 2 , доступного для производства метана.Этот вывод также согласуется с Azlan et al. [13], которые сообщили об увеличении содержания пропионата у коз, получавших ловастатин; и Фаселе Джахроми и др. [10], которые также обнаружили более высокую долю пропионата во время инкубации in vitro с ферментированной рисовой соломой по сравнению с контролем. Для большинства измеренных ЛЖК наблюдался эффект периода. Эффекты были несовместимы с различными ЛЖК, но общее производство ЛЖК за 12 недель увеличилось почти в 1,5 раза по сравнению с 4-недельным измерением.Вышеупомянутое вместе с более высокой микробной популяцией рубца для 12-недельного отбора проб может быть связано с различиями в протоколах отбора проб рубцовой жидкости, предложенных ранее.

    Длительное потребление статинов для лечения гиперлипидемии может привести к миотоксичности скелетных мышц у людей [41–42]. Насколько нам известно, данных о миотоксичности при длительном приеме статинов у сельскохозяйственных животных не поступало. Однако пищевая добавка из красного дрожжевого риса, содержащая ловастатин до 2.6 мг/кг МТ вызывали неблагоприятные пищеварительные и другие физиологические расстройства у крупного рогатого скота [11]. Таким образом, введение передозировки этого соединения в животноводстве может отрицательно сказаться на здоровье и благополучии животных, что приведет к негативным последствиям для благополучия животных. Побочные эффекты на скелетные мышцы, связанные с применением статинов, зависят от дозы [43], поэтому необходимо определить безопасный уровень скармливания соединения животным. Наши результаты показали отсутствие обнаруживаемого ловастатина во всех тканях, проанализированных с помощью ВЭЖХ, в то время как анализ ЖХ-МС/МС образцов из группы, получавшей высокое содержание ловастатина, которую кормили в течение 12 недель, зафиксировал только между 0.от 01 до 0,03 мкг/г (10–30 мкг/кг) ловастатина в тканях. Если предположить, что кто-то съест 200 г мяса, содержащего указанный выше остаток ловастатина, он употребит всего 6 мкг статина, что намного меньше минимальной суточной дозы (10 мг/сут), рекомендованной для лечения гиперхолестерина у людей. 44].

    Данные биохимии крови и гематологии играют жизненно важную роль в определении физиологического, алиментарного и патологического статуса животного [45]. Щелочная фосфатаза крови (ЩФ), аспартатаминотрансфераза (АСТ) и аланинаминотрансфераза (АЛТ) являются полезными индикаторами функции, целостности и инфекции в сердце и печени [46–47].Незначительная разница в этих трех ферментах вместе с уровнем креатинкиназы (КК) в крови, которая связана с воспалением и повреждением мышечных клеток и тканей [48–49], между контрольной и лечебной группами показала, что добавление ловастатина в Группа высокой обработки (6 мг/кг массы тела) не оказала отрицательного воздействия или токсичности на животное. Базофилы и эозинофилы относятся к группе лейкоцитов и являются компонентами аллергического воспаления. В этом исследовании добавление повышенных уровней ловастатина снижало количество базофилов и эозинофилов.Фактически, количество эозинофилов во всех группах лечения и количество базофилов в группе высокого лечения находились в пределах зарегистрированного нормального диапазона 0,05–0,65 x 10 9 900 10 /л и 0–0,12 x 10 9 900 10 /л для эозинофилов и базофилов. , соответственно [50], в то время как контрольной не было. Гистамин, высвобождаемый базофилами, модулируется гистаминазой эозинофилов в ответ на паразитарные инфекции или воспаление желудочно-кишечного или респираторного тракта [51]. Таким образом, наши результаты показали, что животные, которых кормили ловастатином, были на самом деле здоровее в нескольких отношениях.

    Результаты настоящего исследования показывают, что ловастатин, полученный в результате ферментации РКС с Aspergillus terreus , был эффективен в снижении общего холестерина, ЛПНП и ЛПВП в крови (P<0,001). Механизм действия статинов заключается в том, что они ингибируют скорость лимитирующего фермента синтеза холестерина в печени, что приводит к снижению продукции ЛПНП [52]. Вон и др. [52] также сообщили об усилении экспрессии печеночных рецепторов ЛПНП, что затем привело к снижению концентрации ЛПНП в крови.По согласованию с Wang et al. [12] и Azlan et al. [13], поскольку статин является лекарством, известным для лечения гиперлипидемии у людей, в этом исследовании также сообщалось о снижении уровня холестерина в крови у коз, которые потребляли диету, содержащую ловастатин. Для производителя может быть привлекательным производство мяса с более низким содержанием холестерина.

    По результатам этого исследования можно сделать следующие выводы:

    1. Натуральный ловастатин с использованием PKC в качестве субстрата может эффективно снижать выделение кишечного метана у коз.Оптимальный уровень дозировки составляет 4 мг/кг массы тела, что снижает содержание CH 4 /кг DMI примерно на 20% по сравнению с контролем (без ловастатина). Не ожидается дальнейшего снижения выбросов CH 4 при более высокой дозе ловастатина.
    2. Не было существенной разницы в выбросах CH 4 на кг DMI в течение трех периодов, что указывает на долгосрочную эффективность (не менее 12 недель) in situ , продуцирующего ловастатин из PKC, в ​​снижении кишечного выброса CH 4 .
    3. Минимальное воздействие ловастатина на популяцию микробов рубца, включая общее количество метаногенов и метанобактерий (известно, что они ответственны за продукцию CH 4 ), является довольно неожиданным, поскольку значительное снижение эмиссии CH 4 наблюдалось у коз в Среде и Группы высокой обработки. Тем не менее, добавление повышенных уровней ловастатина увеличивало выработку пропионовой кислоты, что свидетельствует о смещении метаболического стока водорода с производства CH 4 .Таким образом, это может частично объяснить снижение выделения CH 4 у коз из групп со средним и высоким уровнем обработки.
    4. Никаких неблагоприятных физиологических эффектов у подопытных животных не было отмечено, за исключением того, что ловастатин (или обработанный РКС) может оказывать негативное влияние на вкусовые качества составленного рациона.
    5. Количество остатка ловастатина, обнаруженное в образцах мяса, печени, почек и головного мозга коз из группы высокого лечения, составляло 0,01–0,03 мкг/г, и, следовательно, количество остатка намного ниже уровня, рекомендуемого для лечения гиперхолестерина у человека. .

    Вспомогательная информация

    S2 Рис. Анализ основных координат (PCoA) структуры сообщества с использованием расстояний Брея-Кертиса.

    На трех рисунках показаны основные координаты (ПК1, ПК2 и ПК3) под разными углами. Красный треугольник указывает на 4-ю неделю, синий квадрат — на 8-ю неделю, а оранжевые точки — на 12-ю неделю.

    https://doi.org/10.1371/journal.pone.0199840.s002

    (TIF)

    Благодарности

    Это исследование финансировалось правительством Новой Зеландии для поддержки целей Исследовательской группы по животноводству Глобального исследовательского альянса по сельскохозяйственным парниковым газам и Университета Путра Малайзии.

    Каталожные номера

    1. 1. Кнапп Дж. Р., Лаур Г. Л., Вадас П. А., Вайс В. П., Трикарико Дж. М. Приглашенный обзор: Кишечно-кишечный метан в молочном животноводстве: количественная оценка возможностей и воздействия сокращения выбросов. Дж. Молочная наука. 2014; 97(6):3231–3261. пмид:24746124
    2. 2. Бенчаар С., Грейтхед Х. Эфирные масла и возможности снижения выбросов кишечного метана жвачными животными. Anim Feed Sci Technol. 2011 г.; 166: 338–355.
    3. 3. Оезтюрк Х., Эмре Б., Сагманлигил В., Пискин И., Фиданчи У.Р., Пеккан М.Влияние низина и прополиса на ферментацию рубца in vitro . J Anim Vet Adv. 2010 г.; 9(21):2752–2758.
    4. 4. Хуан XD, Лян Дж. Б., Тан Х.И., Яхья Р., Хо Ю.В. Влияние конденсированных танинов Leucaena различной молекулярной массы на продукцию in vitro CH 4 . Anim Feed Sci Technol. 2011 г.; 166: 373–376.
    5. 5. Уоллес Р.Дж., Арто Л., Ньюболд С.Дж. Влияние экстракта Yucca shidigera на концентрацию аммиака в рубце и микроорганизмы в рубце.Appl Environ Microbiol. 1994 год; 60: 1762–1767. пмид:8031077
    6. 6. Ван И, Макаллистер Т.А., Янке Л.Дж., Чик П.Р. Влияние стероидного сапонина из экстракта Yucca schidigera на микроорганизмы рубца. J Appl Microbiol. 2000 г.; 88:887–896. пмид:10792550
    7. 7. Христов А.Н., Макаллистер Т.А., Ван Херк Ф.Х., Ченг К.Дж., Ньюболд С.Дж., Чик П.Р. Влияние Yucca schidigera на ферментацию рубца и переваривание питательных веществ у телок. J Anim Sci. 1999 г.; 77:2554–2563. пмид:10492465
    8. 8.Хендерсон Г., Кук Г.М., Ронимус Р.С. Подходы на основе ферментов и генов для разработки метаноген-специфических соединений для контроля выбросов метана жвачными животными: обзор. Аним Прод Наука. 2016; Предстоит.
    9. 9. Миллер Т.Л., Волин М.Дж. Ингибирование роста метанпродуцирующих бактерий преджелудка жвачных ингибиторами гидроксиметилглутарил∼ SCoA-редуктазы. Дж. Молочная наука. 2001 г.; 84 (6): 1445–1448. пмид:11417704
    10. 10. Фаселе Джахроми М., Лян Дж. Б., Мохамад Р., Гох Ю. М., Шокряздан П., Хо Ю. В.Рисовая солома, обогащенная ловастатином, повышает качество биомассы и подавляет метаногенез в рубце. Биомед Рез Инт. 2013; 2013. pmid:23484116
    11. 11. Ramirez-Restrepo CA, O’Neill CJ, López-Villalobos N, Padmanabha J, McSweeney C. Выбросы метана тропическим скотом: роль натуральных добавок статинов. Аним Прод Наука. 2014; 54 (9): 1294–1299.
    12. 12. Ван Л.З., Чжоу М.Л., Ван Дж.В., Ву Д., Ян Т. Влияние замены в рационе обычного риса красным дрожжевым рисом на усвоение питательных веществ, выделение кишечного метана и разнообразие архей рубца у коз.ПлоС один. 2016; 11(7):e0160198. пмид:27467559
    13. 13. Azlan PM, Jahromi MF, Ariff MO, Ebrahimi M, Candyrine SCL, Liang JB. Рисовая солома, обработанная Aspergillus terreus , подавляет выработку метана и улучшает усвояемость корма у коз. Троп Аним Здоровье Прод.2018; 50 (3): 565–571. пмид:2

      05
    14. 14. Клевенхузен Ф., Дюваль С., Зейтц Дж. О., Кройцер М., Солива С. Р. Диаллилдисульфид и ловастатин: влияние на использование энергии и белка у овец, а также на выделение метана овцами.Арх Аним Нутр. 2011 г.; 65 (4): 255–266. пмид:21888032
    15. 15. Джахроми М.Ф., Бу Л.Дж., Ван Х.И., Мохамад Р., Шокряздан П. Производство ловастатина из рисовой соломы с использованием Aspergillus terreus в твердофазной ферментации. Afr J Pharm Pharmacol. 2013; 7 (29): 2106–2111.
    16. 16. АОАС. Официальные методы анализа Ассоциации официальных агрохимиков. 16-е изд. AOAC International, Арлингтон, Вирджиния; 1999.
    17. 17. Ван Соест П.В., Робертсон Дж.Б., Льюис Б.А.Методы определения пищевой клетчатки, нейтрально-детергентной клетчатки и некрахмальных полисахаридов применительно к питанию животных. Дж. Молочная наука. 1991 год; 74 (10): 3583–3597. пмид:1660498
    18. 18. Соареш ЛФП, Гим А., Андраде Феррейра, доктор медицинских наук, Модесто ЕС, Батиста АМВ, Баррос Сейлс Монтейру, доктор медицины. Оценка индикаторов и методология сбора для оценки переваримости питательных веществ у буйволов. R Бюстгальтеры Zootec. 2011; 40: 2005–2010 гг.
    19. 19. Пинарес-Патиньо К.С., Вагхорн Г. Техническое руководство по конструкциям дыхательных камер.Министерство сельского и лесного хозяйства: Веллингтон, Новая Зеландия. 2012. Доступно по адресу: http://www.nzagrc.org.nz/user/file/65/GRA-MAN-Facility-BestPract-2012-FINAL.PDF
    20. 20. Гутьеррес Торал П., Бернар Л., Беленгер А., Руэль Дж., Эрвас Г., Чиллиард Ю. и др. Сравнение метаболизма липидов в рубце у молочных коров и коз, получавших диеты с добавками крахмала, растительного масла или рыбьего жира. J Dairy Sci 1. 2016; 99: 301–316. пмид:26601590
    21. 21. Ван Л., Сюй Ц., Конг Ф., Ян Ю., Ву Д., Мишра С. и др.Изучение микробиома рубца коз от семи дней до двух лет. PloS Один. 2016; 11(5):e0154354. пмид:27135948
    22. 22. Caporaso JG, Kuczynski J, Stombaugh J, Bittinger K, Bushman FD, Costello EK, et al. QIIME позволяет анализировать данные секвенирования с высокой пропускной способностью. Нат Методы. 2010 г.; 7(5):335–336. пмид:20383131
    23. 23. Магоч Т., Зальцберг С.Л. FLASH: быстрая корректировка длины коротких ридов для улучшения сборки генома. Биоинформатика. 2011 г.; 27(21):2957–2963.пмид:21

      9
    24. 24. Ли В., Годзик А. Cd-hit: быстрая программа для кластеризации и сравнения больших наборов последовательностей белков или нуклеотидов. Биоинформатика. 2006 г.; 22 (13): 1658–169. пмид:16731699
    25. 25. Koike S, Kobayashi Y. Разработка и использование конкурентных ПЦР-анализов целлюлозолитических бактерий рубца: Fibrobacter succinogenes , Ruminococcus albus и Ruminococcus flavefaciens . FEMS Microbiol Lett. 2001 г.; 204(2):361–366.пмид:11731149
    26. 26. Сильвестр Дж.Т., Карнати С.К., Ю З., Моррисон М., Фиркинс Дж.Л. Разработка анализа для количественного определения биомассы протозойных инфузорий рубца у коров с использованием ПЦР в реальном времени. Дж Нутр. 2004 г.; 134 (12): 3378–3384. пмид:15570040
    27. 27. Лейн диджей. Секвенирование 16S/23S рРНК. Методы нуклеиновых кислот в бактериальной систематике. В: Stackebrandt E, Goodfellow M., редакторы. John Wiley & Sons, Нью-Йорк, штат Нью-Йорк, США; 1991
    28. 28. Чжоу М.И., Эрнандес-Санабриа Э.Оценка микробной экологии рубцовых метаногенов крупного рогатого скота с разной эффективностью кормления. Appl Environ Microbiol. 2009 г.; 75 (20): 6524–6533. пмид:19717632
    29. 29. Yu Y, Lee C, Kim J, Hwang S. Наборы групповых праймеров и зондов для обнаружения метаногенных сообществ с использованием количественной полимеразной цепной реакции в реальном времени. Биотехнология Биоинж. 2005 г.; 89(6):670–679. пмид:15696537
    30. 30. Бокерт К., Влеминк Б., Фивез В., Майньен Л., Дийкстра Дж., Бун Н.Накопление транс-C18:1 жирных кислот в рубце после добавления в рацион водорослей связано с изменениями в сообществе Butyrivibrio . Appl Environ Microbiol. 2008 г.; 74 (22): 6923–6930. пмид:18820074
    31. 31. Candyrine SCL, Jahromi MF, Ebrahimi M, Liang JB, Goh YM, Abdullah N. In vitro характеристики ферментации рубца коз и овец с добавлением полиненасыщенных жирных кислот. Аним Прод Наука. 2017; 57 (8): 1607–1612.
    32. 32.Паркс Д.Х., Тайсон Г.В., Хугенхольц П., Бейко Р.Г. STAMP: статистический анализ таксономических и функциональных профилей. Биоинформатика. 2014; 30 (21): 3123–3124. пмид:25061070
    33. 33. Пелхен А., Петерс К.Дж. Выбросы метана от овец. Малый Румин Рез 1998; 27(2):137–150.
    34. 34. Миллс Дж. А., Кебреаб Э., Йейтс С. М., Кромптон Л. А., Каммелл С. Б., Дханоа М. С. и др. Альтернативные подходы к прогнозированию выбросов метана от молочных коров. J Anim Sci. 2003 г.; 81 (12): 3141–3150.пмид:14677870
    35. 35. Garnsworthy PC, Craigon J, Hernandez-Medrano JH, Saunders N. Измерения метана на ферме во время доения коррелируют с общим производством метана отдельными молочными коровами. Дж. Молочная наука. 2012 г.; 95(6):3166–3180. пмид:22612952
    36. 36. Мютцель С., Кларк Х. Выбросы метана от овец, которых кормят свежими пастбищами. New Zeal J Agr Res. 2015;58(4):472–489.
    37. 37. Моргави Д.П., Мартин С., Боудра Х. Вторичные метаболиты грибов из видов.уменьшить производство метана в рубце in vitro и in vivo . J Anim Sci. 2013; 91(2):848–860. пмид:23307850
    38. 38. Фаселе Джахроми М., Лян Дж. Б., Хо Ю. В., Мохамад Р., Гох Ю. М., Шокряздан П. и др. Ловастатин в Aspergillus terreus : ферментированные экстракты рисовой соломы препятствуют выработке метана и экспрессии генов в Methanobrevibacter smithii . Биомед Рез Инт. 2013; 2013. pmid:23710454
    39. 39. Хендерсон Г., Кокс Ф., Ганеш С., Йонкер А., Янг В., Янссен П.Х.Состав микробного сообщества рубца варьируется в зависимости от диеты и хозяина, но основной микробиом встречается в широком географическом диапазоне. Научные отчеты. 2015 г.; 5: 14567. pmid:26449758
    40. 40. Волин М.Дж., Миллер Т.Л., изобретатели; Health Research Inc., правопреемник. Способ ингибирования роста метаногенов. Патент США US 5,985,907. 1999.
    41. 41. Эванс М., Рис А. Миотоксичность статинов. Карр Опин Липидол. 2002 г.; 13(4):415–420. пмид:12151857
    42. 42.Ди Стази С.Л., Маклеод Т.Д., Винтерс Д.Д., Биндер-Маклауд С.А. Влияние статинов на скелетные мышцы: взгляд физиотерапевтов. физ. тер. 2010 г.; 90 (10): 1530–1542. пмид:20688875
    43. 43. Антонс К.А., Уильямс К.Д., Бейкер С.К., Филлипс П.С. Клинические перспективы статинового рабдомиолиза. Am J Med. 2006 г.; 119(5):400–409. пмид:16651050
    44. 44. Рубинштейн А., Лурье Ю., Гроскоп И., Вайнтроб М. Эффекты снижения уровня холестерина при суточной дозе 10 мг ловастатина у пациентов с исходным уровнем общего холестерина от 200 до 240 мг/дл (5.от 18 до 6,21 ммоль/л). Ам Джей Кардиол. 1991 год; 68 (11): 1123–1126. пмид:1951068
    45. 45. Какаде М.Л., Саймонс Н.Р., Линер И.Е., Ламберт Дж.В. Биохимическая и питательная оценка различных сортов сои. J Agric Food Chem. 1972 год; 20(1):87–90. пмид:5062148
    46. 46. Syzdek J, Armand M, Gizowska M, Marcinek M, Sasim E, Szafran M, et al. Керамика в полимере по сравнению с полимером в керамике Полимерные электролиты — новый подход. J Источники питания. 2009 г.; 194(1):66–72.
    47. 47.F Adeniyi A, J O Adeleye, C Y Adeniyi. Диабет, сексуальная дисфункция и лечебная физкультура: 20-летний обзор. Curr Diabetes Rev. 2010; 6(4):201–206. пмид:20522020
    48. 48. Бранкаччо П., Маффулли Н., Лимонджелли FM. Мониторинг креатинкиназы в спортивной медицине. Бр Мед Булл. 2007 г.; 81(1):209–230.
    49. 49. Бэрд М.Ф., Грэм С.М., Бейкер Дж.С., Бикерстафф Г.Ф. Влияние креатинкиназы и связанных с физическими упражнениями повреждений мышц на работоспособность и восстановление мышц.Дж Нутр Метаб. 2012 г.; 2012. пмид:22288008
    50. 50. Филдер СЭ. гематологические референтные диапазоны; 2016 [цитировано 27 июля 2017 г.]. Ветеринарное руководство Merck [Интернет] Доступно по адресу: http://www.merckvetmanual.com/appendixes/reference-guides/hematologic-reference-ranges.
    51. 51. Дункансон ГР. Ветеринарное лечение овец и коз. CAB International, Оксфордшир, Великобритания; 2012.
    52. 52. Vaughan CJ, Murphy MB, Buckley BM. Статины делают больше, чем просто снижают уровень холестерина.Ланцет. 1996 год; 348 (9034): 1079–1082.

    Лед (кристаллический метамфетамин) | HealthDirect

    На этой странице

    Что такое лед?

    Лед (кристаллический метамфетамин) представляет собой метамфетамин, член семейства амфетаминовых наркотиков. Он вызывает сильную зависимость и связан с хроническими проблемами физического и психического здоровья.

    Лед является стимулятором центральной нервной системы. Это вызывает высвобождение высоких уровней дофамина (химическое вещество мозга, связанное с удовольствием и вознаграждением).Он чище и мощнее, чем другие виды метамфетамина, такие как спид.

    Выпускается в виде маленьких кристаллов, похожих на лед, или в виде кристаллоподобного порошка от белого до коричневатого цвета. Имеет сильный запах и горьковатый вкус. Его можно вводить, курить, нюхать или глотать.

    Он также известен как кристаллический мет, сябу, кристалл, стекло, тина и осколок.

    Каковы последствия употребления льда?

    Лед производит интенсивный прилив сил, который может заставить человека чувствовать себя уверенно и энергично.У них может быть повышенное половое влечение, зуд и расчесы, расширенные зрачки, учащенное сердцебиение или сухость во рту. Человек может скрипеть зубами или чрезмерно потеть. Эффект может длиться до 12 часов.

    После приема льда в течение нескольких дней может быть трудно заснуть. У людей, которые «сходят с ума», могут быть проблемы со сном, головные боли, паранойя или галлюцинации, они могут чувствовать себя очень раздражительными и грустными.

    Лед может влиять на людей по-разному в зависимости от:

    • сколько берут
    • насколько он силен
    • размер, рост и вес человека
    • привыкли ли брать
    • принимают ли они одновременно другие наркотики

    Узнайте больше о том, как наркотики и алкоголь могут повлиять на ваше здоровье, в том числе о том, где можно найти помощь и поддержку.

    Что может пойти не так со льдом?

    Люди, употребляющие лед, могут страдать паранойей, галлюцинациями, потерей памяти и бессонницей. Частые высокие дозы могут вызвать «ледяной психоз» с параноидальным бредом, галлюцинациями и необычным, агрессивным или насильственным поведением. Это может длиться несколько дней.

    Люди, которые принимают большое количество или крепкую партию, подвергаются риску передозировки. Признаки передозировки включают:

    Передозировка может привести к остановке сердца, потере сознания или смерти.Если вы подозреваете, что у кого-то случилась передозировка льдом, позвоните по номеру три нуля (000) и вызовите скорую помощь. Сотрудникам скорой помощи не нужно вызывать полицию.

    Может ли лед вызвать долгосрочные проблемы?

    У людей, которые постоянно используют лед, могут развиться физические проблемы, включая сильную потерю веса, плохой сон, проблемы с зубами, регулярные простуды, проблемы с концентрацией внимания, ригидность мышц, проблемы с сердцем, проблемы с почками, депрессию или инсульт.

    Люди, регулярно использующие лед, могут выглядеть намного старше, чем должны.Они могут находить повседневную деятельность менее приятной, у них бывают резкие перепады настроения, они впадают в депрессию и легко подвергаются стрессу. Они также подвержены социальным, рабочим и финансовым проблемам.

    Фырканье льда может вызвать кровотечение из носа, проблемы с носовыми пазухами и повреждение носа. Совместное использование игл увеличивает риск столбняка, инфекций, повреждения вен, гепатита В, гепатита С и ВИЧ.

    См. «Каковы последствия приема наркотиков?» на веб-сайте Министерства здравоохранения для получения дополнительной информации.

    Что делать, если я употребляю другие наркотики или алкоголь вместе со льдом?

    Использование льда вместе с такими наркотиками, как спид или экстази, увеличивает риск инсульта.Использование его с алкоголем, каннабисом (марихуаной) или бензодиазепинами увеличивает риск передозировки.

    Могу ли я стать зависимым от льда?

    Людям быстро нужны большие дозы льда, чтобы произвести тот же эффект, что вызывает сильную зависимость от льда. Некоторые потребители считают, что препарат нужен им только для того, чтобы пережить день.

    Отмена может быть сложной и может привести к тяге, повышенному аппетиту, спутанности сознания, раздражительности, болям, истощению, проблемам со сном, беспокойству, депрессии и паранойе.

    Ресурсы и поддержка

    • Вы ​​можете снизить риск заражения ВИЧ и другими заболеваниями, передающимися через кровь, такими как гепатит B и C, с помощью программ обмена игл и шприцев (ПОИШ). Они предоставляют чистые иглы или шприцы людям, употребляющим инъекционные наркотики, и иногда их называют «обменом игл». Найдите NSP в вашем штате или территории здесь.

    • Посетите веб-сайт «Трещины во льду», чтобы получить доказательную информацию и ресурсы о ледяном/кристаллическом метамфетамине для австралийского сообщества.

    • Информацию о льде можно найти на веб-сайте Фонда алкоголя и наркотиков или по телефону 1300 85 85 84
    • .
    • Получите помощь на веб-сайте Drug Help или позвонив на Национальную горячую линию по алкоголю и другим наркотикам по телефону 1800 250 015. Вы также можете позвонить по телефону Lifeline 13 11 14.

    • Если вам или кому-то из ваших знакомых трудно справляться с проблемами, связанными с употреблением наркотиков, воспользуйтесь средством проверки симптомов Healthdirect, чтобы получить совет о том, когда обращаться за профессиональной помощью.

    Помощь и поддержка в вашем штате или территории:

    Преимущества, побочные эффекты, дозировка и взаимодействие

    Сера является распространенным химическим веществом в организме человека. Белки, витамины и другие элементы в организме содержат серу, которая играет важную роль в ряде жизненно важных процессов.

    Некоторые люди считают, что прием добавок серы (капсул или порошков) дает различные преимущества, такие как защита от аллергии, остеоартрита и боли в мышцах.Кроме того, актуальные продукты серы рекламируются как средства для лечения целого ряда кожных заболеваний.

    В этой статье объясняются возможные преимущества препаратов серы для перорального и местного применения, как их можно использовать, побочные эффекты и что вам следует знать, прежде чем попробовать добавки серы или продукты для кожи.

    Нажмите «Играть», чтобы узнать о преимуществах серы

    .

    Для чего используется сера?

    Сера играет важную роль в организме и необходима для производства ключевых белков и строительных блоков этих белков, известных как аминокислоты.Например, сера необходима для синтеза или создания аминокислот цистеина и метионина. Эти аминокислоты являются частью мощного антиоксиданта, известного как глутатион.

    Что такое антиоксидант?

    Антиоксиданты — это вещества в вашем организме, которые могут предотвратить повреждение клеток, поэтому они защищают вас от различных типов болезней и недомоганий


    Сера содержится в различных продуктах питания, а также доступна в качестве добавки. Диметилсульфоксид (ДМСО) и метилсульфонилметан (МСМ) являются типами добавок серы.Хотя эти продукты широко доступны, исследования о пользе серных добавок для здоровья ограничены. До сих пор исследования были сосредоточены на нескольких ключевых областях, представляющих интерес.

    Боль в суставах и мышцах

    Сера является частью традиционных методов лечения, используемых во всем мире для лечения различных заболеваний.

    Метилсульфонилметан

    МСМ, природное соединение серы, содержащееся во многих продуктах питания, может помочь тем, у кого есть различные типы остеоартрита.

    Исследования показали, что МСМ может действовать как противовоспалительное средство и, возможно, защищать хрящ. Для людей с артритом в результате уменьшается боль и улучшается диапазон движений в суставах.

    Бальнеотерапия

    Бальнеотерапия — это альтернативная терапия, которая веками использовалась для облегчения боли в суставах и мышцах в Европе, Азии и на Ближнем Востоке. В бальнеотерапии воспаленные или напряженные суставы и мышцы купаются в горячих источниках и воде, которая содержит серу наряду с другими богатыми минералами.

    Исследования неоднозначны в отношении эффективности бальнеотерапии. Было показано, что он значительно уменьшает боль и улучшает качество жизни людей с остеоартритом. Однако исследование 2015 года показало, что недостаточно доказательств того, что он помогает при симптомах ревматоидного артрита.

    Суть бальнеотерапии: ее можно использовать вместе с другими методами лечения для уменьшения слабовыраженного воспаления и боли или напряжения, связанных со стрессом. Однако врачи не совсем понимают, как и почему помогают эти серосодержащие препараты, поэтому они не могут полностью их одобрить.

    Аллергии

    В качестве противовоспалительного средства МСМ, по-видимому, уменьшает воспаление, вызванное аномальными иммунными реакциями, которые возникают у людей с аллергией на продукты питания или факторы окружающей среды.

    В рандомизированном двойном слепом исследовании исследователи показали, что МСМ значительно облегчает симптомы аллергии. Прием 3 граммов МСМ в день в течение двух недель помог аллергикам лучше дышать и уменьшить заложенность носа.

    Большим преимуществом МСМ является то, что он вызывает меньше побочных эффектов, чем отпускаемые по рецепту лекарства, такие как антигистаминные препараты.Однако на данный момент нет достаточных доказательств того, что МСМ может быть адекватной заменой рецептурным лекарствам от аллергии.

    Перхоть

    Перхоть на самом деле связана с состоянием кожи, которое вызывает зуд, шелушение кожи и возможное покраснение и воспаление. Сера одобрена Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) для использования в безрецептурных средствах от перхоти, которые часто содержат салициловую кислоту.

    После небольшого исследования людей с перхотью в 1987 году было проведено мало исследований.Это исследование показало, что когда люди использовали шампунь, содержащий серу и салициловую кислоту, они сообщали о меньшем шелушении и перхоти. Необходимы дальнейшие исследования, чтобы убедиться, что это лечение эффективно.

    Розацеа

    Розацеа — это состояние кожи, которое выглядит как прыщи у взрослых, но сильно отличается от него. Это вызывает красные, опухшие участки на лице, красные шишки и увеличение носа.

    Было показано, что препараты серы значительно уменьшают покраснение и повреждения, вызванные розацеа.Эти формулы для местного применения, т. е. кремы или лосьоны, наносимые на кожу, также, по-видимому, имеют мало побочных эффектов. Однако некоторые люди имеют повышенную чувствительность к продуктам серы.

    Резюме

    Сера является минералом, необходимым для хорошего здоровья. Помимо поддержки функции организма, он играет роль антиоксиданта и противовоспалительного средства. Исследования показывают, что он может помочь при раздражении кожи, связанном с перхотью и розацеа. Это может также уменьшить воспаление от артрита и аллергии.Необходимы дополнительные исследования, чтобы понять, как работает сера и как она может лучше всего поддерживать хорошее здоровье.

    Возможные побочные эффекты

    Недостаточно известно о пероральных добавках серы, чтобы быть уверенными в их безопасности. Однако есть сообщения о том, что МСМ и ДМСО могут вызывать определенные побочные эффекты, такие как:

    Сера, возможно, безопасна при местном применении. В клинических исследованиях продолжительностью до четырех недель участники безопасно использовали продукты, содержащие серу в концентрациях до 10%.

    Важно отметить, что самолечение состояния с помощью серы и отказ от стандартной помощи или откладывание ее на потом могут иметь серьезные последствия. Поговорите со своим врачом, если вы планируете использовать добавку серы для лечения какого-либо заболевания.

    Дозировка и приготовление

    Рекомендуемой суточной дозы серы не существует. Большинство людей потребляют достаточное количество серы в своем рационе, чтобы удовлетворить потребности организма. Однако по крайней мере одно исследование показало, что потребление серы может быть недостаточным для людей старше 75 лет.

    Стандартной дозы добавок серы не существует. Недостаточно известно о пероральных добавках, чтобы давать такую ​​рекомендацию. Однако в исследованиях эффективно и безопасно использовались различные местные дозы.

    Например:

    • Перхоть: Было показано, что шампуни, содержащие 2% серы и 2% салициловой кислоты, успешно лечат перхоть при использовании два раза в неделю в течение пяти недель.
    • Чесотка: исследования показывают, что мази с 8% и 10% серы, используемые в течение трех дней подряд и трех ночей подряд, эффективно действовали против чесотки.

    Резюме

    Исследователи продолжают изучать, как добавки серы могут поддерживать хорошее здоровье, но многое еще не известно о безопасности и правильном использовании пероральных и местных средств. В целом лосьоны и кремы кажутся безопасными, но пероральные добавки могут вызвать расстройство пищеварения, головокружение и головную боль. Для добавок серы не существует стандартной рекомендуемой дозировки, поэтому поговорите со своим врачом о том, что может подойти для ваших нужд.

    Что искать

    Сера доступна для покупки в Интернете и продается во многих магазинах натуральных продуктов и в магазинах, специализирующихся на пищевых добавках.Вы часто видите добавки серы в форме капсул или продаются в виде кристаллов для использования в ванне.

    Когда вы ищете добавку серы, вы, вероятно, увидите много продуктов с МСМ. МСМ — это природное органическое соединение, содержащее серу. Его также иногда называют диметилсульфоном, метилсульфоном, сульфонилбисметаном или кристаллическим диметилсульфоксидом. МСМ также называют «органической серой».

    Слово «органический» используется для его описания, потому что это углеродсодержащая молекула, а не потому, что она соответствует стандартам Министерства сельского хозяйства США по использованию этого термина в отношении сельского хозяйства, производства и продажи продуктов питания.

    Имейте в виду, что добавки в значительной степени не регулируются Управлением по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA). Выбирая добавку, всегда проверяйте этикетку продукта, чтобы узнать, содержит ли она какие-либо другие ингредиенты.

    Несмотря на то, что продавать пищевую добавку в качестве средства для лечения или лечения болезни или для уменьшения симптомов болезни является незаконным, FDA не тестирует продукты на безопасность или эффективность.

    При выборе добавки старайтесь искать продукты, сертифицированные ConsumerLabs, U.S.S. Фармакопейная конвенция или NSF International. Эти организации не гарантируют, что продукт безопасен или эффективен. Тем не менее, они гарантируют, что продукт был изготовлен надлежащим образом, содержит ингредиенты, указанные на этикетке, и не содержит опасных уровней загрязняющих веществ.

    Резюме

    Существует ограниченное количество высококачественных клинических испытаний, связанных с добавками серы и местным лечением. В целом кажется безопасным использование кремов и лосьонов для облегчения проблем с кожей или боли в суставах.Шампунь от перхоти, содержащий серу, также считается безопасным.

    Неясно, дают ли пероральные добавки ДМСО и МСМ преимущества, и они могут вызывать некоторые незначительные побочные эффекты. Прежде чем что-то добавлять в свой рацион или тратить деньги на непроверенные добавки, обсудите все за и против со своим врачом.

    Часто задаваемые вопросы

    • Какие продукты содержат серу?

      Сера естественным образом содержится в таких продуктах, как молочные продукты, яйца, говядина, птица, морепродукты, лук, чеснок, репа, капуста и брокколи.

    • Какие есть альтернативы сере для уменьшения боли в суставах?

      Занятия йогой или тай-чи и/или акупунктура могут помочь справиться с болью при артрите и облегчить ее, а также улучшить функционирование у некоторых людей.

    • Сера плохо пахнет?

      Чистая сера не имеет запаха. Люди часто предполагают, что неприятный запах тухлых яиц связан с серой, но на самом деле он вызван сероводородом.

    1.Введение

    microbiolresMicrobiology ResearchMicrobiol. Res.Microbiology Research3036-7481MDPI10.3390/microbiolres12020033microbiolres-12-00033ReviewПероральные добавки железа – желудочно-кишечные побочные эффекты и влияние на микробиоту кишечникаhttps://orcid.org/0000-0001-7679-5629BloorSarah R.123*Schutte Гога Бениамино Т. Академический редактор Куркутас Яннис Академический редактор 1 Факультет здравоохранения, образования, медицины и социального обеспечения, Университет Англии Раскин, Челмсфорд CM1 1SQ, Великобритания; Рудольф[email protected]Функциональная диагностика кишечника, Manchester M2 4NG, Великобритания; [email protected]Клиника функционального кишечника, Лондон, W1G 6NB, Великобритания Эта статья находится в открытом доступе и распространяется на условиях лицензии Creative Commons Attribution (CC BY) (https://creativecommons.org/licenses/by/4.0/).

    Железодефицитная анемия (ЖДА) — это всемирная проблема здравоохранения, затрагивающая примерно 25% населения мира.Наиболее распространенным методом лечения ЖДА является прием пероральных препаратов железа, который связан с побочными эффектами со стороны желудочно-кишечного тракта (ЖКТ), такими как запор и вздутие живота. Это может привести к несоблюдению режима лечения и сохранению ЖДА. Внутривенное введение железа не вызывает побочных эффектов со стороны ЖКТ, что может быть связано с отсутствием воздействия на просвет кишечника. Люминальное железо может вызывать изменения в микробиоте кишечника, способствуя развитию патогенных видов и уменьшая количество полезных защитных видов. Железо жизненно важно для метаногенных архей, которым железо необходимо для роста и метаболизма.Повышенное содержание метана в кишечнике связано с замедлением кишечного транзита, запорами и вздутием живота. Здесь мы изучаем литературу, чтобы понять потенциальную связь между железом и метаногенезом, как новый способ понять механизм побочных эффектов желудочно-кишечного тракта, вызванных пероральными добавками железа.

    железозапорвздутие животаметанметаногенымикробиота кишечника1. Введение

    Железодефицитная анемия (ЖДА) поражает до 25% населения мира [1], или примерно 2 миллиарда человек [2].Ежегодно в Великобритании IDA обходится NHS в 55,48 млн фунтов стерлингов и вызывает 57 000 госпитализаций [3]. Некоторые из основных причин дефицита железа включают диетическую недостаточность, кровопотерю, мальабсорбцию, беременность, инфекции, воспаление и воспалительное заболевание кишечника (ВЗК). Подсчитано, что ЖДА возникает у 60–80% пациентов с ВЗК [3] и является наиболее частым внекишечным осложнением ВЗК [4]. Высокая распространенность ЖДА в сообществе ВЗК, вероятно, является многофакторной, включая воспаление, плохое всасывание железа, кишечное кровотечение и ограниченную диету [3].

    Добавки железа широко назначают широкому кругу пациентов для профилактики и лечения дефицита железа (ДЖ) и ЖДА. Внутривенная и пероральная терапия препаратами железа восстанавливает уровень железа. Однако важное необъяснимое клиническое ограничение пероральной терапии железом заключается в том, что она часто вызывает значительные побочные эффекты со стороны желудочно-кишечного тракта (ЖКТ), такие как запор, боль в животе, тошнота и вздутие живота [5,6,7]. Пероральное железо является наиболее распространенным методом лечения ДЖ и ЖДА из-за его низкой стоимости, высокой биодоступности и эффективности [5,6].Существует множество различных видов пероральных добавок железа (таблица 1), но наиболее часто назначаемым пероральным железом является сульфат железа [7]. Добавки двухвалентного железа эффективны; однако они имеют высокую частоту побочных эффектов по сравнению с источниками трехвалентного железа [8]. В качестве терапии первой линии рекомендуется принимать сульфат железа два или три раза в день с максимальной суточной дозой элементарного железа 195 мг [9,10].

    Внутривенное (IV) железо вводится непосредственно в кровоток и, следовательно, в обход просвета ЖКТ.Впервые разработанное внутривенное введение железа было токсичным и плохо переносимым, вызывая анафилаксию и реакции гиперчувствительности [11]. Впоследствии препараты железа для внутривенного введения прошли многочисленные итерации, чтобы разработать более безопасный и лучше переносимый состав. Примером этого является карбоксимальтоза железа, которая не является декстраном и считается безопасной и значительно лучше, чем пероральное железо, при восполнении уровня гемоглобина при однократной дозе 750 мг. Было обнаружено очень мало побочных эффектов при использовании карбоксимальтозы железа с незначительными побочными эффектами и отсутствием необходимости в прекращении лечения [12].

    Внутривенное железо, по-видимому, имеет несколько преимуществ по сравнению с пероральным. О побочных эффектах со стороны желудочно-кишечного тракта сообщается не так часто [9], а комплаентность гораздо выше, что приводит к более быстрому восстановлению гемоглобина и разрешению дефицита железа [10]. Кроме того, у взрослых пациентов с ВЗК внутривенное введение железа более эффективно и хорошо переносится [4]. Многие исследования также сообщают о более быстром восполнении запасов железа в организме [13] из-за высокого поглощения клетками внутривенного железа по сравнению с пероральными добавками, где неабсорбированное железо теряется с фекалиями [14,15].Однако внутривенное введение железа значительно дороже, более чем в 60 раз дороже, чем пероральное [16]. Несмотря на это, анализ экономической эффективности лечения ЖДА у пациентов с ВЗК показал, что карбоксимальтоза железа является наиболее экономически эффективным методом лечения из-за надлежащей приверженности лечению, большого числа пациентов, которые реагируют на лечение, улучшения показателей госпитализации и количества пациентов. качество жизни [17].

    До 60% людей, принимающих препараты железа перорально, сообщают о побочных эффектах со стороны желудочно-кишечного тракта [10].Эти желудочно-кишечные жалобы приводят к тому, что до 50% пациентов, получающих пероральные препараты железа, не соблюдают свой план лечения, что означает, что их ЖДА сохраняется [9]. Однако пациенты, получающие внутривенные инфузии железа, сообщают о меньшей частоте этих побочных эффектов [10], таких как тошнота (1,6% против 4,9%), рвота (1,0% против 6,8%), боль в животе (1,3% против 7,9%). ) и диарея (0,9% против 8,3%) [4]. Поскольку внутривенное введение железа обходит просвет желудочно-кишечного тракта, считается, что наблюдаемые побочные эффекты со стороны желудочно-кишечного тракта в основном обусловлены прямым взаимодействием железа с желудочно-кишечной средой при пероральном введении железа.

    Несмотря на то, что миллионы пациентов принимают препараты железа перорально, механизмы, посредством которых опосредуются побочные эффекты со стороны желудочно-кишечного тракта, плохо изучены. Было предложено множество теорий относительно причины побочных эффектов, вызванных приемом железа, в том числе через гидроксильные радикалы, перекисное окисление липидов, повреждение клеток и изменения микробиоты [18]. Понимание механизма улучшения профиля побочных эффектов может иметь значительные преимущества с точки зрения результатов лечения пациентов и экономики здравоохранения.

    2. Всасывание железа и дозирование терапии железом

    Железо всасывается в двенадцатиперстной кишке и проксимальном отделе тощей кишки.Гемовое и негемовое железо имеют разные механизмы всасывания (рис. 1). Что касается железа гема, белок-носитель гема 1 (HCP-1) транспортирует железо в просвет энтероцита, где двухвалентное железо (Fe 2+ ) высвобождается из кольца протопорфирина XI под действием гемоксигеназы [19]. Негемовое железо сначала превращается из трехвалентного (Fe 3+ ) в железо Fe 2+ с помощью фермента редуктазы дуоденального цитохрома B (DCYTB). Затем транспортер двухвалентных металлов-1 (DMT-1) на апикальной поверхности дуоденальных энтероцитов активно транспортирует восстановленное железо в цитоплазму энтероцитов [19].Железо регулируется на уровне кишечной абсорбции, чтобы предотвратить перегрузку железом, поскольку отсутствует путь выведения железа. Гепсидин является основным регулятором накопления железа в организме. Когда запасы железа и циркулирующее железо в трансферрине достигают точки насыщения, гепатоциты печени вырабатывают гепсидин. Это запускает деградацию ферропортина, трансмембранного белка, участвующего в оттоке железа, предотвращая дальнейшее всасывание железа [20].

    Типичная диета взрослого человека должна содержать от 8 до 15 мг железа в день, при этом ежедневно всасывается в среднем 1–2 мг, чтобы компенсировать потери из организма [21,22].Тем не менее, максимум 25 мг элементарного железа в день может быть поглощен, но это количество только в условиях экстремального дефицита железа [23]. Несмотря на это, клиническое руководство рекомендует лечить железодефицитную анемию таблетками 200 мг сульфата железа перорально, по две или три таблетки ежедневно для пополнения уровня железа [24,25]. Каждая таблетка сульфата железа содержит 65 мг элементарного железа; таким образом, пациенты могут получать до 195 мг элементарного железа в день, что значительно больше, чем оно способно всасываться.Это неабсорбированное железо будет проходить через желудочно-кишечный тракт, взаимодействуя с окружающей средой, прежде чем будет экскретироваться с фекалиями.

    За прошедшие годы было разработано множество добавок железа с целью уменьшения побочных эффектов со стороны желудочно-кишечного тракта. Это было опробовано на железе в таблетках с модифицированным высвобождением или в жидкой форме. Эксперименты на модели in vitro с таблетками сульфата железа, фумарата железа и глюконата железа с обычным высвобождением сравнивали с таблетками сульфата железа с контролируемым высвобождением и аскорбиновой кислотой и капсулами с замедленным высвобождением фумарата железа.Абсорбция железа была значительно выше при приеме сульфата железа с обычным высвобождением, в то время как обе таблетки с модифицированным высвобождением показали низкую абсорбцию. Поэтому таблетки с модифицированным высвобождением противопоказаны из-за низкой абсорбции в результате более медленной скорости высвобождения железа [26]. Жидкие препараты железа обычно смешивают с фруктовыми соками с высокой концентрацией полифенолов, которые, как известно, препятствуют всасыванию железа (таблица 2), поэтому также не рекомендуется [26].

    Было обнаружено, что вода

    Spatone ® iron-Plus является источником железа с высокой биодоступностью.Однако один пакетик воды Spatone Iron-Plus содержит всего 5 мг железа, что гарантирует отсутствие побочных эффектов со стороны желудочно-кишечного тракта. В то время как 28–34% этого количества усваивается, эта форма железа рекомендуется только при здоровой беременности для поддержания уровня железа, поскольку требуется меньшее количество дополнительного железа по сравнению с теми, кто страдает железодефицитной анемией [29,30,31] . Таким образом, Spatone ® не следует использовать для лечения ДЖ или ЖДА.

    Еще одной пероральной добавкой железа, направленной на уменьшение побочных эффектов со стороны желудочно-кишечного тракта, является сахаросомное железо.В сахаросомальном железе бислой фосфолипидов и сахаросома защищают пирофосфат железа до тех пор, пока он не достигнет кишечника. Доклинические данные показывают, что он может быть более переносимым, чем другие пероральные препараты железа, при этом обладая аналогичной эффективностью в восстановлении уровня железа [32].

    Экспериментальные данные свидетельствуют о том, что прием железа два-три раза в день может быть не лучшим способом приема добавок железа, несмотря на то, что это является текущими рекомендациями. Моретти и др. 2015 [33] обнаружили, что высокие дозы пероральных добавок железа вызывают повышение уровня гепсидина, который ингибирует всасывание железа на срок до 24 часов.Они обнаружили, что дозирование с интервалом в 48 часов увеличивает всасывание железа по сравнению с тремя ежедневными дозами, поскольку это дает достаточно времени для снижения уровня гепсидина и устранения блока слизистой оболочки при всасывании [34,35]. Другие группы также подтвердили усиление всасывания железа при однократном приеме один раз в день или при приеме через день [33,34,36].

    В целом, изменение состава препаратов железа снижает побочные эффекты за счет снижения дозировки и, в свою очередь, снижает количество неабсорбированного железа в желудочно-кишечном тракте.Похоже, что лучший способ восстановить уровень железа с наименьшим количеством побочных эффектов — это использовать меньше доз железа (даже всего две дозы в неделю), что также было бы более экономически эффективным [35].

    3. Железо и воспаление

    Как дефицит железа, так и переизбыток железа могут вызывать окислительный стресс. Из-за своей способности принимать или отдавать электроны железо может быть вредным для человеческого организма. Железо содержит ненасыщенные электроны [37] и является прооксидантом [38], способствуя реакции Фентона (уравнение (1)) и реакции Габера-Вейсса (уравнение (2)).Fe 3+ + O 2 + O 2 ÿ → Fe 2+ + O 2 (1) FE 2+ + H 2 o 2 → Fe 3+ + ОН + ОН Ÿ (2)

    В реакции Фентона активные формы кислорода (АФК), такие как перекись водорода (H 2 O 2 ), восстанавливаются электронами с образованием свободных радикалов, таких как ионы гидроксила (OH ) [37,39] . В желудочно-кишечном тракте это может вызвать окислительный стресс в клетках кишечника, вызывая повреждение мембранных белков и перекисное окисление липидов [39].Следовательно, избыток железа в желудочно-кишечном тракте может вызвать повреждение ворсинок кишечника, что приведет к уменьшению высоты, формы и стабильности, а также к повреждению белков плотных контактов между энтероцитами слизистой оболочки [39]. Это вызывает воспаление слизистой оболочки кишечника [37]. Воспаление, в свою очередь, снижает абсорбцию железа, стимулируя выработку и секрецию гепсидина и снижая уровень белка DMT-1 [39].

    4. Железо и кишечная микробиота

    Кишечная микробиота — это микроорганизмы, присутствующие в желудочно-кишечном тракте.Чтобы выжить, эти микроорганизмы используют питательные вещества из рациона человека, поэтому изменения в рационе, дефицит питательных веществ и пероральные лекарства могут оказывать сильное влияние на микробиоту. Одним из питательных веществ, от которого в значительной степени зависит кишечная микробиота, является железо, и его дефицит часто ограничивает рост и вирулентность многих бактерий.

    Как обсуждалось ранее, железосодержащие добавки содержат значительно больше железа, чем может усваиваться организмом. Это означает, что в просвете желудочно-кишечного тракта остается большое количество неабсорбированного железа.Повышенный уровень люминального железа в желудочно-кишечном тракте влияет на состав микробиоты кишечника с повышенным уровнем энтеропатогенов и снижением защитных видов Lactobacilli [40]. Это может быть вызвано приемом пероральных препаратов железа и употреблением обогащенной пищи. Обогащение рациона африканских детей железом (~8 мг/день) привело к увеличению роста патогенных бактерий, таких как сальмонелла, шигелла и кишечная палочка, и уменьшению количества лактобацилл, ответственных за ингибирование колонизации патогенами [41].Исследования, изучающие влияние добавок железа на кенийских младенцев, также обнаружили повышенный уровень Enterobacteriaceae и сниженный уровень Lactobacillus и Bifidobacterium [42]. Однако влияние добавок железа и обогащения на микробиоту кишечника в долгосрочной перспективе неизвестно [43].

    В целом, железо оказывает многостороннее воздействие на микробиоту (рис. 2), но чаще всего оно приводит к усилению роста патогенных видов и уменьшению количества полезных бактерий.Доступность железа для патогенных бактерий настолько важна, что иммунная система млекопитающих разработала пути, известные как алиментарный иммунитет — способность хозяина манипулировать доступностью металлов, опосредованную экспрессией связывающих металлы белков (липокалин-2, лактоферрин, трансферрин и внутриклеточный ферритин), которые может удерживать железо [44,45]. Однако у этого точного механизма мало шансов опосредовать баланс ДЖ в сочетании с перегрузкой железом. Трансферрин и лактоферрин участвуют в алиментарном иммунитете за счет секвестрации железа от вторгшихся патогенов, при этом есть доказательства того, что лактоферрин может увеличивать абсорбцию железа на 56% [46,47,48].Данные о том, может ли лактоферрин уменьшить побочные эффекты ЖКТ, вызванные железом, неоднозначны, но лактоферрин может модулировать воспаление ЖКТ, помогая устранить инфекцию и предотвратить повреждение тканей наряду с уменьшением роста патогенов [49].

    Сочетание добавок железа с пребиотиками и пробиотиками может позволить смягчить изменения микробиоты, вызванные железом. Lactobacillus fermentum увеличивает абсорбцию железа при ДМТ-1, превращая Fe 3+ в Fe 2+ благодаря своей активности по восстановлению железа; следовательно, это может помочь уменьшить побочные эффекты железа со стороны желудочно-кишечного тракта [50].Кроме того, исследования, изучающие добавление кенийским младенцам порошка железосодержащих микронутриентов с пребиотическими галактоолигосахаридами (GOS) и без них, показали, что GOS смягчает неблагоприятное воздействие железа на микробиоту кишечника [51]. Это связано с тем, что GOS и пробиотики снижают рН кишечника, что способствует всасыванию железа [52] в дополнение к усилению комменсальных бактерий для защиты от энтеропатогенов, что предотвращает колонизацию и чрезмерный рост [51]. Таким образом, добавки железа с GOS и лактоферрином могут помочь уменьшить воздействие на микробиоту кишечника за счет увеличения всасывания железа [53].

    На виды архей также может влиять железо, и было высказано предположение, что сульфат железа, более растворимая форма железа, может усиливать рост метаногенных видов [41]. Многочисленные эксперименты показали, что люди, страдающие запорами, имеют более высокое содержание метаногенных видов в кишечной микробиоте, а также более медленное время кишечного транзита и более высокий рН фекальных масс [54, 55, 56, 57, 58]. Кроме того, хорошо известно, что прием пероральных препаратов железа вызывает запоры [9].Однако механистическое объяснение этой взаимосвязи неизвестно.

    5. Метаногены, метаногенез и желудочно-кишечные симптомы

    Метаногены — это древние одноклеточные микроорганизмы, входящие в царство Archaea. Считается, что они присутствуют в небольшом количестве по крайней мере у 30–50% населения [57]. Известно, что многие виды способны колонизировать организм человека, наиболее распространенными из которых являются Methanobrevibacter smithii и Methanosphaera stadtmanae в желудочно-кишечном тракте и Methanobrevibacter oralis в ротовой полости [57].Существует семь порядков метаногенов, принадлежащих к типу Euryarchaeota, причем седьмой порядок, Methanomassiliicoccales, обнаружен совсем недавно [59].

    Метаногены могут производить метан (CH 4 ) посредством ряда реакций метаногенеза (таблица 3) [59]. Метаногенные виды в желудочно-кишечном тракте преимущественно используют реакцию гидрогенотрофного метаногенеза для производства метана, поскольку они используют водород, полученный в результате бактериальной ферментации углеводов [60].Очень немногие другие виды микробиоты способны производить метан, за исключением видов Clostridium и Bacteroides [60,61,62].

    Семейство Christensenellaceae сосуществует с семейством Methanobacteriaceae, и, в частности, Christensenellaceae поддерживает метаболизм M. smithii за счет производства водорода, который затем потребляется M. smithii для производства метана. Кроме того, присутствие M. smithii вызывает изменение продукции короткоцепочечных жирных кислот Christensella minuta в сторону ацетата по сравнению с бутиратом [63], который затем можно использовать для ацетотрофного метаногенеза.

    Метан был связан с замедлением кишечного транзита [56]. Время транзита через рото-цекальный и целостный кишечник значительно уменьшается у продуцентов метана по сравнению с непродуцентами метана [56], а метан ослабляет перистальтические движения в кишечнике, способствуя сокращению нераспространяющихся круговых мышц [57,64]. Хотя существует связь между метаном и запорами, неясно, является ли метан причиной или следствием запоров [58].

    Были предложены теории относительно того, как метан влияет на кишечный транзит.Предполагается, что метан является газообразным медиатором, таким как оксид азота, со способностью проникать через стенку кишечника, опосредуя активность нейронов и гладкой мускулатуры [56]. То, как метан замедляет кишечный транзит, может быть механически похоже на тормоз тощей и подвздошной кишки после приема жира [56]. Серотонин также может играть роль в контроле времени транзита, при этом 95% серотонина в организме находится в желудочно-кишечном тракте [65]. У продуцентов метана снижается уровень серотонина после еды, и было обнаружено, что газ метан ингибирует поглощение серотонина в кровотоке [57,65].

    6. Метаногенез и железо

    В истории Земли основным источником метана был гидрогенотрофный метаногенез в анаэробных железистых океанах. Современный пример этого — озеро Матано в Индонезии, где оксиды железа и метан находятся в большом количестве, и есть подтверждающие доказательства метаногенеза в присутствии низкореакционноспособного Fe 3+ [61]. Эксперименты по производству биогаза также свидетельствуют в пользу метаногенеза, поддерживаемого железом. Было обнаружено, что добавление нульвалентного железа в ферментеры водорослей или сточных вод увеличивает производство метана до 17% [62,66].

    Железо, наряду с другими металлами, является важным микроэлементом для роста метаногенов, метаболизма и ферментативной активности [67]. Это связано с большим количеством ключевых белков в метаногенах, использующих железо-серные (Fe-S) кластеры [68], от которых зависит метаногенез [69]. Однако железо может быть важным для метаногенеза и другими способами, в том числе в качестве источника электронов при восстановлении диоксида углерода до метана (уравнение (3)). Эксперименты по коррозии металлов показали, что железо может окисляться в результате реакции метаногенеза с образованием газообразного метана и созданием энергии, способствующей росту метаногенных видов [70].Реакция метаногенеза – единственный способ получения метаногенами энергии для роста [71]. Однако некоторые данные свидетельствуют о том, что чистые культуры гидрогенотрофных метаногенов могут иметь снижение продукции метана в присутствии железа [72]. 8H + + 4Fe 0 + CO 2 → CH 4 + 4Fe 2+ + 2H 2 O  ΔG

    9 O’

    Сульфатредуцирующие бактерии (SRB) и метаногены живут в сходной среде и, как следствие, часто конкурируют за одни и те же субстраты [73], что, в свою очередь, может ограничивать метаногенез.Железо может помочь метаногенам превзойти SRB, поскольку железо может осаждать сульфиды до сульфида железа (FeS) [74]. Это способствует метаногенезу, предотвращая образование сероводорода (H 2 S), который токсичен для метаногенов и SRB [75].

    7. Модулирование метана и метаногенов

    Хотя было обнаружено, что несколько лекарств и добавок влияют на выработку метана, мало что известно о том, как эффективно уменьшить выработку метана или полностью уничтожить метаногены.

    Повышение содержания метана является прямым биомаркером, коррелирующим с медленным транзитом, а снижение содержания метана имеет клиническое значение; поэтому важно понимать способы снижения содержания метана.В то время как большинство антибиотиков не подходят для лечения избыточной продукции метана, комбинация рифаксимина и неомицина эффективна для снижения количества метаногенов с одновременным улучшением симптомов запора [76,77,78]. Прием этих антибиотиков в сочетании с агентом, стимулирующим подвижность, может помочь предотвратить восстановление метаногенов [79].

    Мевалонатный путь, на который нацелены препараты, снижающие уровень холестерина (статины), участвует в образовании холестерина для клеточных стенок архей.Следовательно, путь мевалоната архей может действовать как подходящая мишень для снижения содержания метана. Имеются данные о том, что ловастатин может ингибировать биосинтез клеточной стенки архей при преобразовании в его гидроксикислотную форму, не влияя на другие бактерии, следовательно, избирательно воздействуя на метаногены [80,81]. На первом этапе биосинтеза холестерина происходит ингибирование 3-гидрокси-3-метилглутарил-кофермента А-редуктазы (ГМГ-КоА-редуктазы). Экстракт красного дрожжевого риса содержит химически идентичные соединения ловастатину, монаколин К, а экстракт вешенки естественно содержит ловастатин, поэтому они также являются потенциальными кандидатами на снижение метанового газа в желудочно-кишечном тракте [82,83].

    Добавка атрантил также может быть изучена для искоренения метана. Имеющиеся данные свидетельствуют о преимуществе метан-положительных пациентов с частотой ответа 88% пациентов с СРК с преобладанием запоров и заметным улучшением как запоров, так и болей в животе [84]. Однако это не было проверено вместе с тестированием дыхания, чтобы выяснить, сопровождается ли уменьшение симптомов снижением уровня метана.

    Морские водоросли могут быть природным антиметаногенным соединением [85].Овцы, живущие на шотландском побережье Оркнейских островов и питающиеся морскими водорослями, не производят никакого метана [86] по сравнению с 70–120 кг метана в год, вырабатываемыми крупным рогатым скотом [87]. Виды морских водорослей, такие как Asparagopsis taxformis и Asparagopsis armata, содержат бромоформы и дибромхлорметан, которые могут предотвратить образование метана во время пищеварения [85,88]. Всего 1–2 % Asparagoposis в день в корме для крупного рогатого скота может снизить выработку метана до 70 % [89], а 5 % A.Taxiformis может снижать уровень метана на 95 % [90]. В настоящее время нет доказательств того, что морские водоросли снижают уровень метана в организме человека, и их можно исследовать дальше.

    Другими вариантами лечения метаном могут быть трансплантация фекальной микробиоты (ТФМ). Ранее это работало при ликвидации инфекции Clostridium difficile; однако только недавно он был постулирован как средство для лечения избыточного роста метаногена [91]. Пробиотики, содержащие Lactobacillus reuteri (DSM 17938), также могут быть полезными, поскольку исследования у младенцев с хроническими запорами показывают, что L.reuteri может увеличить частоту дефекации [92]. Кроме того, известно, что прием L. reuteri в течение 4 недель снижает выработку метана [58]. Мультиштаммовые пробиотики, используемые у взрослых с функциональными запорами, сокращали время транзита по кишечнику на 13,75 ч и увеличивали количество еженедельных дефекаций [93]. В том же метаанализе использование составов с несколькими штаммами также значительно уменьшало вздутие живота; однако производство метана не оценивалось.

    Повышение абсорбции железа снизит доступность метаногенов.Было показано, что пробиотический штамм Lactiplantibacillus plantarum 299v увеличивает абсорбцию железа. Исследование с участием беременных женщин, принимавших капсулу, содержащую L. plantarum 299v, вместе с 4,2 мг железа и низкими дозами фолиевой кислоты и аскорбиновой кислоты в первом триместре, показало улучшение статуса железа по сравнению с плацебо [94]. Таким образом, исследование пробиотиков, которые могут улучшить усвоение железа, может быть способом модулирования производства метана.

    8. Выводы и будущие направления

    Известно, что пероральные добавки железа вызывают изменения микробиоты, которые потенциально могут включать увеличение количества метаногенных видов.Будущие эксперименты необходимы для дальнейшего понимания механизма (механизмов) разработки эффективных методов лечения, обеспечивающих лучшее соблюдение режима приема препаратов железа и повышение рентабельности медицинских услуг. Это потребует оценки биомаркеров бактериальной ферментации и состава микробиоты до и после приема пероральных препаратов железа и сбора информации о спровоцированных симптомах.

    Существует несколько потенциальных методов лечения, нацеленных на метаногены; однако, помимо антибиотиков, остается мало доказательств их способности снижать образование метана и ограничивать рост метаногена.Важные будущие направления в этой области требуют оценки эффективности различных методов лечения, рассмотренных в этом обзоре.

    Мы выделили текущие клинические проблемы с пероральными добавками железа. Хотя они эффективны для восстановления уровня железа у пациентов с ЖД и ЖДА, они плохо переносятся значительной частью пациентов, включая сообщество пациентов с ВЗК. Их частые побочные эффекты со стороны желудочно-кишечного тракта могут привести к несоблюдению режима лечения и, следовательно, к задержке восстановления уровня железа, что приводит к воспалению желудочно-кишечного тракта.Однако механизм, с помощью которого пероральные добавки железа вызывают эти побочные эффекты со стороны желудочно-кишечного тракта, неизвестен.

    Мы предполагаем, что потенциальные причины желудочно-кишечных побочных эффектов, вызванных пероральными добавками железа, включают изменения в микробиоте кишечника. Вероятным механизмом могут быть метаногенные археи, метаногенез и активация газообразного метана. Имеющиеся данные свидетельствуют о том, что железо необходимо для поддержки роста метаногенных видов и производства метана. Это, вместе с растущими клиническими данными о влиянии метаногенов на ряд симптомов и состояний желудочно-кишечного тракта, делает его привлекательной мишенью.Намечены дальнейшие шаги по изучению механизма побочных эффектов со стороны желудочно-кишечного тракта, вызванных пероральным приемом железа.

    Вклад авторов

    S.R.B. и А.Р.Х. разработал концепцию статьи. С.Р.Б. подготовил рукопись; Р.С. и А.Р.Х. дал критическую оценку рукописи. Все авторы прочитали и согласились с опубликованной версией рукописи.

    Финансирование

    Это исследование не получило внешнего финансирования.

    Заявление Институционального контрольного совета

    Неприменимо.

    Заявление об информированном согласии

    Неприменимо.

    Благодарности

    Мы благодарим Selim Cellek и Malwina Naghibi за их комментарии к рукописи.

    Конфликты интересов

    Энтони Хобсон является соучредителем компании Functional Gut Diagnostics и имеет долю в компании.

    Ссылки1. BethellD.R.HuangJ.Рекомбинантный человеческий лактоферрин для лечения глобальных проблем со здоровьем: дефицит железа и острая диареяJ. Биометаллы20041733734210.1023/B:БИОМ.0000027714.56331.b82. ZimmermannMBHurrellR.F.Пищевой дефицит железаLancet200737051152010.1016/S0140-6736(07)61235-53. BartonC.CowanK.FauldsJ.HollowayD.JohnstonS.MasonI.McMahonA.Дефицит железа и анемия у взрослых: RCN Guidance for Nursing PracticeДоступно онлайн: https://www.rcn.org.uk/professional-development/publications/pub-007460( по состоянию на 4 января 2021 г.)4. BonovasS.FiorinoG.AlloccaM.LytrasT.TsantesA.Peyrin-BirouletL.DaneseS.Внутривенное и пероральное введение железа для лечения анемии при воспалительных заболеваниях кишечника: систематический обзор и метаанализ рандомизированных контролируемых исследованийMedicine201695e230810.1097/MD.0000000000002308267654075. SantiagoP.Ferrous по сравнению с трехвалентным пероральным препаратом железа для лечения дефицита железа: клинический обзорSci. Мир J.2012201284682410.1100/2012/8468246. GrzywaczA.LubasA.FiedorP.FiedorM.NiemczykS.Безопасность и эффективность внутривенного введения препаратов железаActa Pol. Фарм2017741324294747577. LowM.S.Y.SpeedyJ.StylesC.E.De-RegilL.M.PasrichaS.-R.Ежедневные добавки железа для улучшения состояния при анемии, состояния железа и улучшения здоровья женщин в период менструации Cochrane Database Syst.Ред.201610.1002/14651858.CD009747.pub28. WuT.-W.TsaiF.-P. Сравнение терапевтических эффектов и побочных эффектов пероральных добавок железа при железодефицитной анемии. TolkienZ.StecherL.ManderA.P.PereiraD.I.PowellJJJПрием добавок сульфата железа вызывает серьезные желудочно-кишечные побочные эффекты у взрослых: систематический обзор и метаанализPLoS ONE201510e011738310.1371/journal.pone.011738310. CançadoR.D.MuñozM. Внутривенная терапия железом: как далеко мы продвинулись? Rev.Бюстгальтеры. Гематол. Гемотер.20113346146910.5581/1516-8484.2011012311. MacdougallI.C.VernonK.Псевдоаллергия, связанная с активацией комплемента: свежий взгляд на реакции гиперчувствительности на внутривенное введение IronAm. Дж. Нефрол.201745606210.1159/0004510692789411512. OnkenJ.E.BregmanD.B.HarringtonR.A.MorrisD.AcsP.AkrightB.BarishC.BhaskarB.S.Smith-NguyenG.N.ButcherA.Многоцентровое, рандомизированное, активно-контролируемое исследование по изучению эффективности и безопасности внутривенного введения железа Карбоксимальтоза у пациентов с железодефицитной анемией. Трансфузия20145430631510.1111/трф.1228913. BhandalN.RussellR. Внутривенная и пероральная терапия железом при послеродовой анемии BJOG20061131248125210.1111/j.1471-0528.2006.01062.x14. SteinJ.DignassA.U. Лечение железодефицитной анемии при воспалительном заболевании кишечника — практический подходAnn. Гастроэнтерол.2013261041132471487415. KortmanG.A.BoleijA.SwinkelsD.W.TjalsmaH.Доступность железа увеличивает патогенный потенциал Salmonella Typhimurium и других энтеропатогенов на границе кишечного эпителияPLoS ONE20127e2996810.1371/journal.pone.00299682227226516. LeeT.W.KolberM.R.FedorakR.N.van ZantenS.V.Заместительная терапия железом у пациентов с воспалительными заболеваниями кишечника и железодефицитной анемией: систематический обзор и метаанализJ. Колит Крона2012626727510.1016/j.crohns.2011.09.0102240516117. AksanA.SchoepferA.JuilleratP.VavrickaS.BettencourtM.Ramirez de ArellanoA.GavataS.MorinN.ValentineW.HuntB.Iron Препараты железа для лечения железодефицитной анемии у пациентов с воспалительным заболеванием кишечника: анализ экономической эффективности в ШвейцарииAdv.Тер.20213866067710.1007/с12325-020-01553-118. QiX.ZhangY.GuoH.HaiY.LuoY.YueT.Механизм и меры вмешательства при побочных эффектах железа на кишечникCrit. Преподобный Food Sci. Нутр.2019602113212510.1080/10408398.2019.163059919. PrzybyszewskaJ.ŻekanowskaE. Роль гепсидина, ферропортина, белков HCP1 и DMT1 в абсорбции железа в пищеварительном тракте человекаPrz. Гастроэнтерол.2014920821310.5114/стр.2014.4510220. Риши Г. Субраманиам В. Н. Печень в регуляции гомеостаза железа Ам.Дж. Физиол. Гастроинтест. Физиол печени.2017313G157G16510.1152/ajpgi.00004.201721. FuquaB.K.VulpeC.D.AndersonG.J.Всасывание железа в кишечникеJ. Трейс Элем. Мед. биол. Орган Соц. Шахтер. Trace Elem.20122611511910.1016/j.jtemb.2012.03.01522. Дешемин Дж.-К.Нордин М.-Л.Ремот А.Виллемец А.Афиф К.Канонн-Эрго Ф.Лангелла П.Карим З.Ваулон С.Томас М.Микробиота изменяет восприятие железа кишечными клеткамиFASEB J.20163025226110.1096/fj.15-27684023. SchrierS.L. Итак, вы знаете, как лечить железодефицитную анемиюBlood2015126197110.1182/кровь-2015-09-66651126494

    . Сценарий NICE: Управление|Управление|Анемия — дефицит железа|CKS|NICEДоступно в Интернете: https://cks.nice.org.uk/topics/anaemia-iron-deficiency/management/management/ (по состоянию на 11 января 2021 г.)25. CookJ.D. Диагностика и лечение железодефицитной анемии Best Pract. Рез. клин. Гематол.20051831933210.1016/j.beha.2004.08.0221573789326. ZariwalaM.G.SomavarapuS.FarnaudS.RenshawD.Сравнительное исследование пероральных препаратов железа с использованием модели кишечника человекаSci.Фарм.2013811123113910.3797/сцифарм.1304-0327. ZijpI.M.KorverO.TijburgL.B.M.Влияние чая и других диетических факторов на усвоение железаCrit. Преподобный Food Sci. Нутр.20004037139810.1080/104086

    1891941102

    8. TempelM.ChawlaA.MessinaC.ÇelikerM.Y.Влияние омепразола на всасывание железа: предварительное исследованиеTurk. Ж. Гематол.20133030710.5152/тж.ч.2013.004229. HalksworthG.MoseleyL.CarterK.WorwoodM.Поглощение железа из Spatone (натуральная минеральная вода) для предотвращения дефицита железа во время беременностиClin.лаборатория Гематол.20032522723110.1046/j.1365-2257.2003.00525.x128

    30. McKennaD.SpenceD.HagganS.E.McCrumE.DornanJCLappinT.R.A Рандомизированное исследование по изучению богатой железом природной минеральной воды в качестве средства профилактики дефицита железа в PregnancyClin. лаборатория Гематол.20032590.1046/j.1365-2257.2003.00501.x31. WorwoodM.EvansW.D.VillisR.J.BurnettA.K.Поглощение железа из природной минеральной воды (Spatone Iron-Plus)Доступно онлайн: https://onlinelibrary.wiley.com/doi/abs/10.1111/j.1365-2257.1996.tb00732.x (по состоянию на 10 июля 2019 г.) 32. Gómez-Ramirez S.BrilliE.TarantinoG.MuñozM.Sucrosomial® Iron: железо нового поколения для улучшения пероральных добавокPharmaceuticals2018119710.3390/ph2104009733. MorettiD.GoedeJ.S.ZederC.JiskraM.ChatzinakouV.TjalsmaH.Melse-BoonstraA.BrittenhamG.SwinkelsD.W.ZimmermannM.B.Железосодержащие добавки для перорального приема повышают гепсидин и снижают абсорбцию железа при ежедневном или двукратном приеме в день у молодых женщин с дефицитом железаBlood20151261981198910 .1182/кровь-2015-05-64222334.StoffelN.U.ZederC.BrittenhamG.M.MorettiD.ZimmermannM.B.Поглощение железа из добавок больше при приеме через день, чем при приеме через день, у женщин с железодефицитной анемией Haematologica20123210.3324/гематол.2019.2208303141308835. HawamdehH.M.RawashdehM.AughsteenA.A.Сравнение пероральной терапии препаратами железа один раз в неделю, два раза в неделю и ежедневно у иорданских детей, страдающих железодефицитной анемиейMatern. Детское здоровье J.20131736837310.1007/s10995-012-0981-336. Стоффель Н.U.CercamondiC.I.BrittenhamG.ZederC.Geurts-MoespotA.J.SwinkelsD.W.MorettiD.ZimmermannM.B.Всасывание железа из пероральных добавок железа, принимаемых последовательно или через день, и в виде однократной утренней дозы по сравнению с раздельной дозировкой два раза в день в Женщины с дефицитом железа: два открытых рандомизированных контролируемых исследования Junqueira FrancoM.M.V.NicolettiC.F.NoninoC.B.VannucchiH.MarchiniJ.S.Окислительный стресс после приема препаратов железа при болезни КронаJ.клин. Реп. корпуса 20166210.4172/2165-7920.100085838. Раджендран С. Бобби З. Хабибулла С. Джейкоб С. Э. Различия в реакции на добавки железа на окислительный стресс, воспаление и гематологические параметры у беременных женщин без анемии и анемии. Материн. Fetal Neonatal Med.20201710.1080/14767058.2020.172299639. DingH.YuX.ChenL.HanJ.ZhaoY.FengJ.Допустимый верхний уровень потребления железа повреждает кишечник и изменяет кишечную флору у поросят-отъемышей Metallomics2020121356136910.1039/D0MT00096E40.OhC.-K.MoonY. Диетические и дозорные факторы, ведущие к гемохроматозу. Циммерманн М.Б.Чассар, К.Ронер, Ф.Н’горан, Э.К.Нинджин, К.Досталь, А.Утцингер, Дж.Гатташ, Х.Лакруа, К.Харрелл, Р.Ф. Влияние обогащения железом на микробиоту кишечника у африканских детей: рандомизированное контролируемое исследование в Кот-д’Ивуаре, Ам. . Дж. Клин. Нутр.2010921406141510.3945/ajcn.110.0045642096216042. ДжеггиТ.КортманГ.А.М.МореттиД.ЧассарК.ХолдингП.ДостальА.БёкхорстДж.ТиммерманХ.M.SwinkelsD.W.TjalsmaH.Обогащение железом отрицательно влияет на микробиом кишечника, увеличивает обилие патогенов и вызывает воспаление кишечника у кенийских младенцевGut20156473174210.1136/gutjnl-2014-3077202514334243. YilmazB.LiH.Микробиота кишечника и железо: решающие факторы здоровья и болезнейPharmaceuticals2018119810.3390/ph210400983030114244. ПулР.К.Достижения в области биологии бактериальных патогеновElsevier Science & TechnologyKent, UK2014978-0-12-800305-345. Черайил Б.Дж. Роль железа в иммунном ответе на бактериальную инфекцию. Иммунол.Рез.2011501910.1007/s12026-010-8199-12116169546. Яценко И.Марра А.Бокете Ж.-П.Пенья Ж.Леметр Б.Секвестрация железа трансферрином 1 опосредует пищевой иммунитет у Drosophila MelanogasterProc. Натл. акад. науч. США20201177317732510.1073/pnas.1

  • 01173218878747. Микулич, Н.Уйога, М.А.Мваси, Э.Стоффель, Н.У.Зедер, С.Каранджа, С.Циммерманн, М.Б.Поглощение железа выше из апо-лактоферрина и сходно между холо-лактоферрином и сульфатом железа: исследования стабильных изотопов железа у кенийских младенцев Дж.Нутр.20201503200320710.1093/jn/nxaa22648. КеллД.Б.ХейденЭ.Л.ПреториусЭ.Биология лактоферрина, железосвязывающего белка, который может помочь защититься от вирусов и бактерий. Иммунол.202011122110.3389/фиму.2020.0122149. Драго-Серрано М.Э.Кампос-Родригес Р.Карреро Х.К.де ла Гарса М.Лактоферрин: Балансирование подъемов и спадов воспаления, вызванного микробными инфекциями, Int. Дж. Мол. Sci.20171850110.3390/ijms1803050150. ГонсалесА.ГальвесН.МартинХ.РейесФ.Перес-ВикторияИ.Домингес-ВераХ.M. Идентификация ключевой экскретируемой молекулы Lactobacillus Fermentum, связанной с усвоением железа хозяином. Food Chem.201722837438010.1016/j.foodchem.2017.02.00851. Паганини, Д. Уйога, М. А. Кортман, Г. А. М. Черкамонди, С. И. Моретти, Д. Барт-Джегги, Т. Шваб, С. Боекхорст, Дж. Тиммерман, Х. М. Лакруа, С. Пребиотические галактоолигосахариды, смягчающие неблагоприятное воздействие обогащения железом на микробиом кишечника: рандомизированное контролируемое исследование в Kenyan InfantsGut2017661956196710.1136/gutjnl-2017-3144182877488552. РусуИ.G.SuharoschiR.VodnarD.C.PopC.R.SocaciS.A.VulturarR.IstratiM.MoroșanI.FărcașA.C.KerezsiA.D.Влияние добавок железа на микробиоту кишечника и эффект потребления пробиотиков при дефиците железа — обзор на основе литературыNutrients202012199310 .3390/nu1207199353. ЦиммерманнМ.Б.Глобальный взгляд на пищевой и функциональный дефицит железа в младенчествеГематол. Являюсь. соц. Гематол. Образовательный Программа2020202047147710.1182/гематология.202000013154. AttaluriA.JacksonM.ValestinJ.RaoSSCМетаногенная флора связана с измененным толстокишечным транзитом, но не с характеристиками стула при запорах без IBSAm.Ж. Гастроэнтерол.20101051407141110.1038/айг.2009.65555. Стивен А.М.Виггинс, Х.С.Энглист, Х.Н.Коул, Т.Дж.Уэйман, Б.Дж.Каммингс, Дж.Х. Влияние возраста, пола и уровня потребления пищевых волокон из пшеницы на функцию толстого кишечника у тридцати здоровых субъектов. Дж. Нутр.19865634936110.1079/BJN1986011656. PimentelM.LinH.C.EnayatiP.van den BurgB.LeeH.R.Chen J.H.ParkS.KongY.ConklinJ.Methan, газ, вырабатываемый кишечными бактериями, замедляет кишечный транзит и увеличивает сократительную активность тонкого кишечникаAm.Дж. Физиол. Гастроинтест. Физиол печени.2006290G1089G109510.1152/ajpgi.00574.200457. TriantafyllouK.ChangC.PimentelM.Метаногены, метан и моторика желудочно-кишечного трактаJ. Нейрогастроэнтерол. Мотиль.201420314010.5056/жнм.2014.20.1.312446644358. OjettiV.PetruzzielloC.MignecoA.GnarraM.GasbarriniA.FranceschiF.L.Reuteri у пациентов с запорами, продуцирующими метан, Eur. преподобный мед. Фармакол. Sci.2017211702170859. Гасин.Боррель,Дж.Тотти,У.О’Тул,П.В.Брюгер,Дж.Ф.Археи и кишечник человека: новое начало старого мира сказок,Дж.Гастроэнтерол.201420160621607810.3748/wjg.v20.i43.160622547315860. Нкамга В.Д.Хенриссат Б.Дранкур М.Археи: основные обитатели пищеварительной микробиоты человека. Микробиом J.201731810.1016/j.humic.2016.11.00561. БрейМ.С.ВуДж.РидБ.К.КрецК.Б.БеллиК.М.СимистерР.Л.ХенниС.СтюартФ.Дж.ДиКристинаТ.Дж.БрандесДж.А.Сдвигающиеся микробные сообщества поддерживают многолетнее восстановление железа и метаногенез в железистых отложениях, инкубациях, геобиологии, 20171567868910. 1111/gbi.1223962. ГенгС.SongK.LiL.XieF.Улучшение производства метана в водорослевом иле и обезвоживаемость с помощью ферментации с нулевым валентным железомAcs Omega202056146615210.1021/acsomega.0c0017463. RuaudA.Esquivel-ElizondoS.de la Cuesta-Zuluaga J.WatersJ.L.AngenentL.T.YoungblutN.D.LeyRE.E.Синтрофия через межвидовой перенос h3 между Christensenella и Methanobrevibacter лежит в основе их глобального совместного появления в кишечнике человека. 03235-193201980364. СуриДж.КатарияР.МаликЗ.А.ПаркманХ.П.ШейР.Повышенные уровни метана при избыточном бактериальном росте тонкой кишки предполагают задержку тонкого и толстокишечного транзита. PimentelM.KongY.ParkS.IBS Субъекты с метаном в дыхательном тесте с лактулозой имеют более низкие постпрандиальные уровни серотонина, чем субъекты с HydrogenDig. Дис. Sci.200449848710.1023/B:DDAS.0000011607.24171.c01499244066. Карпентер А.У.Лотон, С.Н.Визнер, М.Р.Улучшенное производство биогаза в наноразмерных анаэробных биореакторах с нулевым валентным железом.англ. Sci.20153264765510.1089/ees.2014.056026337. Юнал Б. Перри В. Р. Шет М. Гомес-Альварес В. Чин К.-Й. Нюссляйн К. Микроэлементы влияют на метаногенную активность и разнообразие обогащения из подземных угольных пластов, добываемых на водном фронте. Микробиолог.2012317510.3389/fmicb.2012.0017568. Дир Т.М.Лесснер, Ф.Х.Дуин, Э.К.Лесснер, Д.Дж. Создание древнего кофактора: биогенез железо-серного кластера у метаногенных архей. 1Proceedings of the Diverse Life and its Detection on Different Worlds, Меса, Аризона, США, 24–28 апреля 2017 г., 350769.DeereT.M.PrakashD.LessnerF.H.DuinECLessnerD.J.Methanosarcina Acetivorans содержит функциональную систему ISC для кластерного биогенеза железо-сераBMC Microbiol.20202032310.1186/s12866-020-02014-z70. Дэниелс Л. Белай Н. Раджагопал Б. С. Веймер П. Дж. Бактериальный метаногенез и рост из CO2 с элементарным железом в качестве единственного источника электронов. Вайс Д.С.Тауэр Р.К. Метаногенез и единство биохимии Cell19937281982210.1016/0092-8674(93)
  • -G72.Сиван О.Шуста С.С.Валентин Д.Л.Метаногены быстро переходят от производства метана к восстановлению железа. Чоу Х.-Х.Хуанг Дж.-С.Чен В.-Г.Охара Р. Кинетика конкурентных реакций сульфатредуцирующих и метаногенных бактерий в анаэробных фильтрахБиоресурс. Техн.2008998061806710.1016/ж.биортех.2008.03.0441844833474. GeH.ZhangL.BatstoneD.J.KellerJ.YuanZ.Влияние дозировки соли железа в канализационные трубы на последующие анаэробные шламонакопители: контроль сульфидов и производство метанаJ.Окружающая среда. Eng.201313959460110.1061/(ASCE)EE.1943-7870.000065075. LiuY.ZhangY.NiB.-J.Нулевой валентное железо одновременно увеличивает производство метана и восстановление сульфатов в анаэробных реакторах с гранулированным илом. PimentelM.ChangC.ChuaK.S.MirochaJ.DiBaiseJ.RaoS.AmichaiM.Антибиотикотерапия синдрома раздраженного кишечника с преимущественным запоромDig. Дис. Sci.20145

    128510.1007/s10620-014-3157-877. ПиментелМ.ЛембоА.ЧейВ.Д.ЗаккоС.РингелЙ.Ю.Дж.Марея,С.М.Шау,А.Л.Бортей,Э.Форбс,В.П.Рифаксиминовая терапия у больных с синдромом раздраженного кишечника без запоров Н.Н. англ. J. Med.2011364223210.1056/NEJMoa100440978. PimentelM.ChatterjeeS.ChowE.J.ParkS.KongY.Neomycin улучшает синдром раздраженного кишечника с преобладанием запоров способом, который зависит от присутствия газообразного метана: субанализ двойного слепого рандомизированного контролируемого исследованияDig. Дис. Sci.2006511297130110.1007/s10620-006-9104-679. KresserC.PimentelM.A Новое понимание SIBO и IBS, с Марком PimentelДоступно онлайн: https://chriskresser.com/a-new-understanding-of-sibo-and-ibs-with-mark-pimentel/(по состоянию на 20 октября 2020 г.)80. GottliebK.LeC.WacherV.SlimanJ.CruzC.PorterT.CarterS.Выбор порогового значения для производителей с высоким и низким содержанием метана с использованием точечного дыхательного теста на метан: результаты большого набора данных по водороду, метану и углекислому газу в Северной Америке Измерения в дыханииГастроэнтерол. Респ.2017519319910.1093/gastro/gow04881. Hubert S.ChadwickA.WacherV.CoughlinO.Kokai-KunJ.BristolA.Разработка состава ловастатина с модифицированным высвобождением, нацеленного на кишечные метаногены, связанные с синдромом раздраженного кишечника с запоромJ.фарм. Sci.201810766267110.1016/j.xphs.2017.09.02882. Candyrine S.CLMahadzirM.F.GarbaS.JahromiM.F.EbrahimiM.GohY.M.SamsudinA.A.SaziliA.Q.ChenW.L.GaneshS.Влияние ловастатина природного происхождения на усвояемость корма, ферментацию рубца, микробиоту и выбросы метана у коз в течение 12-недельного периода леченияPLoS ONE201813e019984010.1371/journal.pone.01998402997571183. Рамакришнан М. Дубей С. Туласи В. Кислай П. Манохар Н. Исследование ловастатина, молекулы лекарства против гиперхолестеринемии из трех видов вешенки Int.Дж. Биомед. клин. 20172263184. Браун, К. Скотт-Хой, Б. Дженнингс, Л. В. Реакция пациентов с синдромом раздраженного кишечника с запорами, которым вводили комбинированное дерево квебрахо / конкера / M. Balsamea Willd ExtractWorld J Gastrointest Pharm.2016746346810.4292/wjgpt.v7.i3.46385. ThompsonL.R.RowntreeJ.E.Invited Review: Источники метана, количественная оценка и смягчение последствий в системах выпаса говядиныAppl. Аним. Sci.20203655657310.15232/aas.2019-0195186. KirbyE.J. Овцы, питающиеся водорослями, которые хорошо отрыгивают. Доступно онлайн: https://www.bbc.com/news/stories-50856275 (по состоянию на 30 марта 2020 г.) 87. Исследование Университета Аделаиды демонстрирует потенциал снижения содержания метана у коров. RoqueB.M.VenegasM.KinleyR.D.de NysR.DuarteT.L.YangX.KebreabE.Добавка из красных морских водорослей (Asparagopsis Taxiformis) снижает кишечный метан более чем на 80 процентов в мясных бычкахPLoS ONE202116e024782010.1371/journal.pone.0247806438930.0 Смит Дж.Морские водоросли как инструмент снижения содержания метана в животноводстве | Экология коралловых рифов по состоянию на 30 марта 2020 г.)90. RoqueB.M.BrookeC.G.LadauJ.PolleyT.MarshL.J.NajafiN.PandeyP.SinghL.KinleyR.SalwenJKEffect of Macroalgae Asparagopsis Taxiformis на продукцию метана и сборку микробиома рубца. Микробиом201

    .1186/s42523-019-0004-43349993391. Арониадис О.C.BrandtLJ.Кишечная микробиота и эффективность трансплантации фекальной микробиоты при желудочно-кишечном заболевании.Гастроэнтерол. Гепатол.20141023023792. CoccorulloP.StrisciuglioC.MartinelliM.MieleE.GrecoL.StaianoA.Lactobacillus Reuteri (DSM 17938) у младенцев с функциональным хроническим запором: двойное слепое рандомизированное плацебо-контролируемое исследованиеJ. Педиатрия201015759860210.1016/j.jpeds.2010.04.0662054229593. ZhangC.JiangJ.TianF.ZhaoJ.ZhangH.ZhaiQ.ChenW.Мета-анализ рандомизированных контролируемых исследований влияния пробиотиков на функциональные запоры у взрослыхClin.Нутр.2020392960296910.1016/j.clnu.2020.01.00594. AxlingU.ÖnningG.Martinsson NiskanenT.LarssonN.HanssonS.R.HulthénL.Влияние Lactiplantibacillus Plantarum 299v вместе с низкой дозой железа на статус железа у здоровых беременных женщин: рандомизированное клиническое исследованиеActa Obstet. Гинекол. Scand.202110.1111/aogs.1415333880752Рисунки и таблицыРисунок 1

    Всасывание железа в организме. Это может быть в форме гемового или негемового железа. Гемовое железо транспортируется в цитоплазму энтероцитов двенадцатиперстной кишки через HCP-1 (белок-носитель гема 1), где гемовое железо затем удаляется из кольца протопорфирина X1 с помощью гемоксигеназы.Затем железо Fe 2+ образует часть cLIP (пул цитозольного лабильного железа). Негемовое железо должно находиться в двухвалентном состоянии перед попаданием в просвет энтероцита. DCYTB (дуоденальный цитохром B) восстанавливает железо Fe 3+ до железа Fe 2+ , а затем DMT-1 (переносчик двухвалентных металлов 1) переносит Fe 2+ в энтероцит, где он образует часть cLIP. Железо в cLIP может либо связываться с ферритином для хранения, либо транспортироваться из энтероцита через ферропортин и гефестин, которые окисляют железо до его трехвалентного состояния и могут связываться с трансферрином в крови для транспортировки по телу.

    фигура 2

    Краткое изложение влияния железа на желудочно-кишечный тракт. Пероральные добавки железа вызывают у 60% пациентов побочные эффекты со стороны желудочно-кишечного тракта, такие как запор, тошнота и вздутие живота. Известно, что железо вызывает воспаление кишечника за счет производства АФК. Железо также вызывает изменения в микробиоте кишечника, повышая уровень энтеропатогенов и снижая количество защитных видов, и может вызывать изменения в архейных видах.

    microbiolres-12-00033-t001_Таблица 1Таблица 1

    Три наиболее распространенных пероральных препарата железа, используемых для лечения железодефицитной анемии.

    Добавка железа для приема внутрь Доза (мг) Доза элементарного железа (мг)
    Сульфат железа 200 65
    Фумарат железа 200 65
    Глюконат железа 300 35
    микробиолрес-12-00033-t002_Таблица 2Таблица 2

    Пищевые продукты и лекарства, которые либо усиливают, либо подавляют всасывание гемового и негемового железа [27,28].

    Увеличение поглощения Уменьшить поглощение
    Аскорбиновая кислота (витамин С) Антацидные препараты (например, ингибиторы протонной помпы)
    Мясо Фитаты и полифенолы
    Рыба Кальций
    микробиолрес-12-00033-t003_Таблица 3Таблица 3

    Методы метаногенеза различными метаногенами.

    Тип метаногенеза Подложки Механизм
    Гидрогенотрофный Водород или формиат Субстраты могут восстанавливать углекислый газ с образованием метана
    Метилотрофный Метанол, метилсульфиды, метиламины Метильная группа субстрата превращается в метан с помощью специфических метилтрансфераз
    Ацетотрофный Ацетат Ферментация ацетата или декарбоксилирование до диоксида углерода с последующим восстановлением

    Примечание издателя: MDPI сохраняет нейтралитет в отношении юрисдикционных претензий в опубликованных картах и ​​институциональной принадлежности.

    комбинированное влияние добавок монензина и 3-нитрооксипропанола на выбросы метана, скорость роста и эффективность конверсии корма у мясного скота, получающего корма с высоким содержанием фуража и зерна1 | Журнал зоотехники

    Получить помощь с доступом

    Институциональный доступ

    Доступ к контенту с ограниченным доступом в Oxford Academic часто предоставляется посредством институциональных подписок и покупок. Если вы являетесь членом учреждения с активной учетной записью, вы можете получить доступ к контенту следующими способами:

    Доступ на основе IP

    Как правило, доступ предоставляется через институциональную сеть к диапазону IP-адресов.Эта аутентификация происходит автоматически, и невозможно выйти из учетной записи с проверкой подлинности IP.

    Войдите через свое учреждение

    Выберите этот вариант, чтобы получить удаленный доступ за пределами вашего учреждения.

    Технология Shibboleth/Open Athens используется для обеспечения единого входа между веб-сайтом вашего учебного заведения и Oxford Academic.

    1. Щелкните Войти через свое учреждение.
    2. Выберите свое учреждение из предоставленного списка, после чего вы перейдете на веб-сайт вашего учреждения для входа.
    3. При посещении сайта учреждения используйте учетные данные, предоставленные вашим учреждением. Не используйте личную учетную запись Oxford Academic.
    4. После успешного входа вы вернетесь в Oxford Academic.

    Если вашего учреждения нет в списке или вы не можете войти на веб-сайт своего учреждения, обратитесь к своему библиотекарю или администратору.

    Войти с помощью читательского билета

    Введите номер своего читательского билета, чтобы войти в систему. Если вы не можете войти в систему, обратитесь к своему библиотекарю.

    Члены общества

    Многие общества предлагают своим членам доступ к своим журналам с помощью единого входа между веб-сайтом общества и Oxford Academic. Из журнала Oxford Academic:

    1. Щелкните Войти через сайт сообщества.
    2. При посещении сайта общества используйте учетные данные, предоставленные этим обществом. Не используйте личную учетную запись Oxford Academic.
    3. После успешного входа вы вернетесь в Oxford Academic.

    Если у вас нет учетной записи сообщества или вы забыли свое имя пользователя или пароль, обратитесь в свое общество.

    Некоторые общества используют личные аккаунты Oxford Academic для своих членов.

    Личный кабинет

    Личную учетную запись можно использовать для получения оповещений по электронной почте, сохранения результатов поиска, покупки контента и активации подписок.

    Некоторые общества используют личные учетные записи Oxford Academic для предоставления доступа своим членам.

    Институциональная администрация

    Для библиотекарей и администраторов ваша личная учетная запись также предоставляет доступ к управлению институциональной учетной записью.Здесь вы найдете параметры для просмотра и активации подписок, управления институциональными настройками и параметрами доступа, доступа к статистике использования и т. д.

    Просмотр ваших зарегистрированных учетных записей

    Вы можете одновременно войти в свою личную учетную запись и учетную запись своего учреждения. Щелкните значок учетной записи в левом верхнем углу, чтобы просмотреть учетные записи, в которые вы вошли, и получить доступ к функциям управления учетной записью.

    Выполнен вход, но нет доступа к содержимому

    Oxford Academic предлагает широкий ассортимент продукции.

  • Добавить комментарий

    Ваш адрес email не будет опубликован.