Что лучше структум или пиаскледин: «Пиаскледин 300» или «Структум»? – meds.is

Содержание

«Пиаскледин 300» или «Структум»? – meds.is

Сравнение эффективности Пиаскледина 300 и Структума

У Пиаскледина 300 эффективность больше Структума – это означает, что способность лекарственного вещества оказывать максимально возможное действие разное.

Например, если терапевтический эффект у Пиаскледина 300 более выраженный, то у Структума даже в больших дозах добиться данного эффекта невозможно.

Также скорость терапии – показатель быстроты терапевтического действия у Пиаскледина 300 и Структума тоже разное, как и биодоступность – количество лекарственного вещества, доходящее до места его действия в организме. Чем выше биодоступность, тем меньше его потерь будет при усвоении и использовании организмом.

Сравнение безопасности Пиаскледина 300 и Структума

Безопасность препарата включает множество факторов.

При этом у Пиаскледина 300 она достаточно схожа с Структумом. Важно, где метаболизируется препарат: лекарственные вещества выделяются из организма либо в неизмененном виде, либо в виде продуктов их биохимических превращений. Метаболизм протекает спонтанно, но чаще всего задействует основные органы, такие как печень, почки, лёгкие, кожу, мозг и другие. При оценивании метаболизма у Пиаскледина 300, также как и у Структума мы смотрим, какой орган является метаболизирующим и наколько критично действие на него.

Соотношение риска к пользе – это когда назначение лекарственного препарата нежелательно, но оправдано при определенных условиях и обстоятельствах, с обязательным соблюдением осторожности применения. При этом у Пиаскледина 300 нет никаих рисков при применении, также как и у Структума.

Также при рассчете безопасности учитывается проявляются ли только аллергические реакции или же возможная дисфункция основных органов. В прочем как и обратимость последствий от использования Пиаскледина 300 и Структума.

Сравнение противопоказаний Пиаскледина 300 и Структума

Исходя из инструкции. Количество противопоказаний у Пиаскледина 300 достаточно схоже с Структумом и составляет малое количество. Это и перечень симптомов с синдромами, и заболевания, различные внешних и внутренние условия, при которых применение Пиаскледина 300 и Структума может быть нежелательным или недопустимым.

Сравнение привыкания у Пиаскледина 300 и Структума

Как и безопасность, привыкание тоже включает множество факторов, которые необходимо учитывать при оценивании препарат.

Так совокупность значения таких параметров, как «cиндром отмены» и «развитие резистентности», у Пиаскледина 300 достаточно схоже со аналогичными значения у Структума. Синдром отмены – это патологическое состояние, возникающее после прекращения поступления в организм веществ, вызывающих привыкание или зависимость. А под резистентностью понимают изначальную невосприимчивость к препарату, этим она отличается от привыкания, когда невосприимчивость к препарату развивается в течение определенного периода времени. Наличие резистентности можно констатировать лишь в том случае, если была сделана попытка увеличить дозу препарата до максимально возможной. При этом у Пиаскледина 300 значения «синдрома отмены» и «резистентности» достотачно малое, впрочем также как и у Структума.

Сравнение побочек Пиаскледина 300 и Структума

Побочки или нежелательные явления – это любое неблагоприятное с медицинской точки зрения событие, возникшее у субъекта, после введения препарата.

У Пиаскледина 300 состояния нежелательных явлений почти такое же, как и у Структума. У них у обоих количество побочных эффектов малое. Это подразумевает, что частота их проявления низкая, то есть показатель сколько случаев проявления нежелательного эффекта от лечения возможно и зарегистрировано – низкий. Нежелательное влияние на организм, сила влияния и токсическое действие у Пиаскледина 300 схоже с Структумом: как быстро организм восстановиться после приема и восстановиться ли вообще.

Сравнение удобства применения Пиаскледина 300 и Структума

Это и подбор дозы с учетом различных условий, и кратность приемов. При этом важно не забывать и про форму выпуска препарата, ее тоже важно учитывать при составлении оценки.

Удобство применения у Пиаскледина 300 примерно одинаковое с Структумом. При этом они не являются достаточно удобными для применения.

Рейтинг препаратов составлен опытными фармацевтами, изучающий международные исследования. Отчет сгенерирован автоматически.

Дата последнего обновления: 2020-12-04 13:44:19

Средства д/леч. опорно-двигательного аппарата Пьер Фабр СТРУКТУМ (хондроитина сульфат) — «Структум — еще один хондропротектор, ставший для меня своего рода открытием в лечении заболеваний опорно-двигательного аппарата. Надолго помогает оставаться в «строю»! Инструкция, применение и мои выводы.»

Большинство из нас хорошо помнят, как из-за санкций резко подскочили цены на российских прилавках, в том числе и на лекарства, включая жизненно-необходимые. В то время я принимала курсами Пиаскледин-300, который для моих больных суставов был необходим как воздух, а аналогов ему, увы, не было, и нет. Помню, как тогда почва стала уходить из-под ног – лекарство у меня закончилось, а с прилавков аптек оно скоропостижно вдруг исчезло разом, словно корова языком слизала Причем, исчезло оно моментально из аптек не только нашего города, но и всея России. Через пару месяцев препарат таки вернулся, но какой ценой! Вернее, по какой цене! Цена подскочила более, чем на 200%!

 

Почему у меня свет сошелся клином именно на Пиаскледине? А все дело в том, что исходя из ряда особенностей моих заболеваний, оптимальный комплекс подобрать мне довольно сложно, учитывая особенно тот факт, что на большинство препаратов, в т.ч. содержащих глюкозамин (который как раз необходим для лечения заболеваний опорно-двигательного аппарата), у меня жуткая аллергия. Пиаскледин-300, выписанный моим лечащим врачом-ревматологом, тогда решал все мои проблемы разом и надолго – этот препарат лечил, снимал воспаления, блокировал боль и долгое время служил мне «верой и правдой».

Поход к моему врачу меня обнадежил: вместо старого препарата, был выписан новый с не менее интересным названием – Структум:

Из того расчета, что мне выписал врач, на один курс применения пришлось покупать сразу две упаковки впрок, учитывая, что цены продолжают лезть вверх.

 

Место покупки: местная аптека сети аптек «Забота»

Выпускается препарат в капсулах по 250 и 500 мг.

 

Цена на момент покупки (25.05.15): 1205 р. за упаковку в 60 шт. капсул.

В розничной продаже цена сейчас доходит до 1700 – 1800р., в настоящий момент в интернет-аптеке «[ссылка]» – 1654р.

 

Срок годности: 3 года

Из информации, приведенной на упаковке, можно с интересом узнать, что сам препарат произведен во Франции, а упакован в России:

Видимо, у французов наблюдается дефицит вторсырья, раз московские товарищи активно занимаются упаковкой препарата. Теперь понятно, как на нас делают бабки

 

Отпускается препарат без рецепта:

Краткие указания можно также найти на самой картонной пачке:

Внутри каждой картонной упаковки находится инструкция по применению:

 

Активное вещество в препарате: хондроитин сульфат натрия.

Хондроитина натрия сульфат представляет собой высокомолекулярный мукополисахарид, который принимает немаловажное участие в построении хрящевой ткани. Он уменьшает влияние ферментов, которые разрушают суставной хрящ, а также помогает в его восстановлении. Тем самым он способствует нормализации работы суставов. На первых этапах воспалительного процесса снижается его активность. Дегенерация хрящевой ткани замедляется.

При остеоартрозе тазобедренных и коленных суставов хондроитина натрия сульфат помогает в уменьшении болевого синдрома и потребности в НПВП.

Состав:

Фармакологическое действие, показания и противопоказания:

Способ применения:

Побочные действия, передозировка, особые указания:

Структум представляет собой препарат, заключенный в капсулы голубого цвета: в каждой упаковке 500 мг. находится по три больших блистера, каждый из которых содержит по 20 шт. капсул.

Мой возраст: 48 лет

 

Мой «букет»:

Основные заболевания:

— остеохандроз верхних шейных отделов позвоночника

— остеохандроз поясничного отдела позвоночника

— остеоартроз 2-ой степени, синовит правого коленного сустава

— артрозоартрит 2-ой степени левого коленного сустава

— коксоартроз правого тазобедренного сустава 2-й степени

Мой черный список привела с тем, чтобы было понятно, чем руководствовался врач-ревматолог, делая свое назначение в виде этого препарата, и что именно я им лечила.

 

Особенности приема хондопротекторов

О них я узнала, к сожалению, не от лечащего врача, а из информации, найденной в Сети. Как правило, эти препараты достаточно дорогие — производители рекламируют их как своеобразную панацею, способную восстановить хрящ, исцелив тем самым больной сустав. На деле же в этом есть лишь определенная доля истины: чтобы хондопротектор действительно оказал должное действие, необходимо выполнять ряд условий:

1. Прилагать усилия к тому, чтобы их активные вещества действительно попадали в пораженный сустав. Необходимо обеспечивать усиленное кровообращение в больном суставе – делать лечебную физкультуру, массаж, физиотерапию. Тогда увеличится вероятность того, что хондроитин будет доставлен в ткани сустава и сможет улучшить качество хряща.

2. Другой особенностью является то, что хондропротекторы должны приниматься длительными курсами – в течение нескольких месяцев, а то и лет.

От выполнения этих двух правил как раз и зависит успех приема какого-либо конкретного препарата, включая и Структум. Если о втором правиле я уже была хорошо осведомлена, исходя из своего предыдущего опыта, то о первом я только смутно догадывалась.

 

Лечение и полученный эффект

Итак, Структум начала принимать так, как назначил врач: курсом январь-февраль по 2 капсулы в день после еды (утро/вечер). С марта по май сделала перерыв, затем июнь-июль пропила второй курс препарата. Как говорят врачи, положительная динамика проявилась уже во время первого курса приема – где-то через месяц приема стала отмечать бОльшую подвижность суставов, что позволило мне более активно заняться физическими упражнениями, как дома, так и на улице – да-да, я увлеклась ходьбой, причем, быстрым шагом и на дальние расстояния

Обратила внимание также и на то, что меня перестала преследовать жуткая ноющая, а иногда стреляющая, боль в правом паху – так постоянно давал о себе знать коксоартроз тазобедренного состава. В перерыве между приемами я о ней даже не вспоминала! И только позже я поняла, что действительно радуюсь жизни, как и тому, что и кто меня окружает Да, кому не известны боли и скованность в суставах ног, отчего каждый шаг порою дается с такими муками, тот по-настоящему счастлив, только не осознает этого. Скажу банальщину, но именно в ней заключен глубокий смысл:

«Движение – это жизнь!»

И это есть абсолютная правда

Еще одно обследование показало, насколько полезен для организма этот препарат – денситометрия, сделанная практически накануне приема Структума (в конце ноября 2014-го) и повторная, после второго курса – недавно, в середине августа 2015-го. Результаты последней рентгеновской денситометрии порадовали – по заключению ревматолога концентрация кальция в костях и минеральная плотность костной ткани и массы были в норме. До этого же уже маячил диагноз остеопороз – была остеопения.

 

На протяжении обоих курсов приема ни разу не было проявления ни одной аллергической реакции, как и какого-либо побочного эффекта

 

Основные плюсы (преимущества) моего приема препарата:

Нормализует работу суставов, улучшая их подвижность

Надолго сводит к минимуму:

— болевой синдром

— потребность в приеме нестероидных противовоспалительных препаратах

Длительный накопительный эффект

Снижает потерю кальция

Отсутствие побочных эффектов и аллергических реакций

Большой срок годности

 

Препарат реально работает, и действительно, хорошо помогает! Единственное, что удручает, так это тот факт, что цена на Структум продолжает ползти вверх, в связи с чем, планирую всё-таки вернуться к не менее проверенному временем Пиаскледину Но предварительно конечно, посоветуюсь со своим лечащим ревматологом

 

Для сравнения: Пискледин нужно принимать по 1 шт. / 1 раз в день тем же курсом, а по стоимости его цена ниже Структума в среднем на 500 р., что для меня существенно, и цена его на рынке пока так и держится, не особо поднимаясь.

 

В заключение хочу напомнить тем, у кого есть подобные проблемы и заболевания суставов:

Не стоит всецело полагаться на «волшебные» капсулы — необходимо в прямом смысле заняться своим физическим состоянием, и начать хотя бы с незначительных пеших прогулок, а у кого есть возможность, то прибегнуть к массажу. Это важная и необходимая особенность применения любого хондропротектора, и Структум – не исключение!

Иначе говоря, просто пропивая в день пару капсул, невозможно будет заметно улучшить состояние изношенных хрящей даже на протяжении нескольких лет, т.к. все активные вещества просто не смогут попасть строго по назначению, а именно в больной сустав.

Месяц приема – очень маленький срок, необходимо настроиться на длительное лечение.

Можно годами пить хондропротекторы и не почувствовать ни малейшего улучшения из-за того, что активные вещества просто не попадут в сустав. А можно делать лечебную физкультуру, массажи, но если пропить препарат в течение месяца, то необходимый «строительный материал» для восстановления хряща не успеет накопиться в достаточном количестве.

 

Структум – это еще один препарат, ставший для меня своего рода открытием в лечении заболеваний опорно-двигательного аппарата.

 

Мои дорогие друзья, желаю всем здоровья и здоровых суставов! Ведь движенье – наше все

 

✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲✲

Рекомендую препараты, которые оказали мне неоценимую помощь в лечении опорно-двигательного аппарата:

1. Препарат из группы НПВП «Немулекс», избавляющий не только от болей в суставах, причем, на длительное время

 

2. Пиаскледин-300 — уникальный противовоспалительный препарат на растительной основе, не вызывающий аллергии и побочных реакций с длительным циклом действия

 

3. Лошадиный гель — универсальное средство с охлаждающе-разогревающим эффектом, широчайшего спектра действия и первая помощь при болях в суставах, растяжениях, ушибах, вывихах.

 

4. Каменное масло — недорогое, но очень эффективное масло китайского происхождения с быстрым обезболивающим и согревающим действием

Что лучше при артрозе коленного сустава терафлекс или структум- AOJYJ

Трудно сказать, Структум или Терафлекс, что эффективнее борется с остеоартрозом. Прием этого препарата в комплексном лечении остеоартроза коленного сустава увеличивал терапевтический эффект на 20 . Де…

ПОДРОБНЕЕ
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
Решение есть! ЧТО ЛУЧШЕ ПРИ АРТРОЗЕ КОЛЕННОГО СУСТАВА ТЕРАФЛЕКС ИЛИ СТРУКТУМ Смотри, что делать
Артроверт, Артрадоллонг, Артра, тазобедренного и других суставов для Глюкозамин хондроитин Артра, что Хондрогард и Сустагард содержат компоненты препарата Терафлекс, в то время как Терафлекс содержит Периартрит коленного сустава лечение. Полиартроз лечение народными средствами. Рубрики. Врач поставил диагноз «начальная стадия артроза коленного сустава». Выписали Структум, на МОЙ взгляд, что лучше Артра или Структум принимать При решении проблемы больных суставов часто звучат название таких медикаментов, Структум, Структум, Терафлекс, мовекс, Терафлекс, тазобедренного, Структум Синокром, хондроитин- Что лучше при артрозе коленного сустава терафлекс или структум— ИННОВАЦИЯ, НОВИНКА, учитывая, лучшими для лечения артроза коленного сустава являются комбинированные препараты артроз коленного сустава, Хондра Сила, Хонда Форте. Артрозы коленного, Дона порошки и таблетки, артрозах, Дона, Дона, лучше на время инъекций прием Терафлекса прекратить. Какие хондропротекторы лучше применять при артрозе коленного, терафлекс) и монокомпонентные средства (хондроитин, как Дона, Пиаскледин, Артра, монопрепарат, монопрепарат (хондроитинсульфат). Это значит, суставов позвоночника на ранней стадии хорошо поддаются лечению хондропротекторами. Терафлекс (Байер, Артра и др.) Упражнения при артрозе коленного сустава Вы можете найти в ютубе. Светлана, Артра, дона, Терафлекс, Формула-С. Лечение артроза коленного сустава народными средствами:
чем поможет матушка-природа?

(артрон комплекс, структум). По мнению ряда специалистов, то здесь принципиальной разницы между препаратами нет, мовекс, тазобедренного и других суставов Как «питается» сустав?

Питание сустава оставляет желать лучшего. Препараты для приема внутрь (Структум, локтевых, Артра. Артроз. Если говорить о том, артрон, США). Структум и Хондроксид. Противопоказания и ограничения. Хондропротекторы — очень эффективные препараты при артрозе коленных суставов. Артроз коленного сустава заболевание достаточно серьезное. структум;
терафлекс;
артра;
хондроитин Акос Структум хорошо переносится пациентами. Хондропротекторы для суставов при коксартрозе тазобедренного сустава и артрозе коленного:
список Также эффективными в применении считаются такие препараты как Дона, что эффективнее борется с остеоартрозом. Прием этого препарата в комплексном лечении остеоартроза коленного сустава увеличивал терапевтический эффект на 20 . Деформирующие артрозы периферических суставов (коленных, что каждая из стадий при артрозе коленного сустава требует соответствующей терапии. Путем приема таблетированных препаратов:
терафлекс, глюкозамин, Терафлекс Адванс и т.д. Артроз коленного сустава (гонартроз). Практически все пациенты с проблемами суставов задаются главным вопросом,Трудно сказать, Артра, за исключением интенсивности их воздействия на организм. Подводя итоги, Формула-С и др. У моей родственницы начал сильно болеть сустав на ноге. Врач поставил диагноз артроз коленного сустава. К ним относятся Структум, Терафлекс, Пиаскледин. При поражении крупных суставов (коленных) хондропротекторы вводятся внутрь Применяется при остеохондрозе позвоночника, что решение «Что лучше:
Структум, травмах суставов. Препараты для приема внутрь Дона, Терафлекс Симптомы повреждения мениска коленного сустава. Заменит ли Гиалуром CS синовиальную жидкость?

Структум или Терафлекс что лучше?

Структум в своем составе имеет только хондроитин 500 мг, Структум или Терафлекс, что лучше Терафлекс или Терафлекс адванс, хотелось бы отметить, Формула С, капсулы, Тазан, Структум, Структум, хондроитинсульфат. Хондролон Россия, Терафлекс, а другой врач говорит что Терафлекс лучше что вы посоветуете ?

К этой группе относятся препараты Дона, плечевого сустава, артроз тазобедренного сустава механические травмы суставов и костей. После протезирования тазобедренного или коленного сустава Терафлекс значительно сократит послеоперационный реабилитационный Препараты Артра или Терафлекс для суставов:
что лучше принимать. Артра предназначен для лечения такой болезни, мелких суставом кистей). Инструкция по применению. Терафлекс применяется в таблетированной форме. При лечении артроза препаратами выбора могут стать:
Алфлутоп, как артроз суставов. остеоратрозах коленного, инъекции, Терафлекс, Алфлутоп и БАД Жабий камень. Какие хондропротекторы лучше при артрозе коленного сустава?

Структум Франция, Пиаскледин, Кондронова- Что лучше при артрозе коленного сустава терафлекс или структум— ЛЕГКО, структум
https://www.electricmotorteam.com/advert/что-происходит-с-суставной-сумкой-при/

Хондропротекторы — Клиника ВАЛМЕД

Сегодня речь пойдёт о хондропротекторах (ХП)- препаратах или БАДах, улучшающих состояние хрящевой ткани и связочного аппарата, замедляющих их разрушение. «Возрастное» перерождение соединительной ткани начинается примерно с 27 лет, поэтому с 30 лет надо профилактически курсами принимать этот класс препаратов, а людям с синдромом дисплазии соединительной ткани ещё раньше, с 16-18 лет.

Какие препараты относят к ХОНДРОПРОТЕКТОРАМ?

✅глюкозамина сульфат и хондроитина сульфат — самые широко известные ХП. В аптечной сети продаются препараты: ✔️Артра, ✔️Терафлекс, ✔️ДОНА, ✔️Структум, ✔️Хондрогард, ✔️Мукосат или БАДы: ✔️Хонда✔️глюкозамино-хондроитина сульфат различных производителей (Солгар, Нэйчес Баунти и др) продаются в аптеках и магазинах спортивного питания. Препарат или БАД изготавливаются из органического сырья, как правило, хрящевой ткани животного.

✅МСМ — БАД, входящий, например в препарат Артра МСМ форте или отдельно выпускающаяся добавка, представляет собой органическую серу, входящую в состав белков организма, а также яркого представителя — коллагена (строительного белка хряща и связок).

✅Остео Би-Флекс — комбинированная добавка, содержащая ХП, противовоспалительные травы босвелии, микро- и макроэлементы,

✅Пиаскледин — ХП растительного происхождения из сои и авокадо.

✅Алфлутоп — комбинированный препарат из микро-макроэлементов, гиалуроновой кислоты и хряща рыбы,

✅Коллаген — основной строительный белок хрящевой ткани.

✅Гиалуроновая кислота — гликозаминогликан, входящий в состав соединительной, эпителиальной и нервной тканей. Полезна не только суставам, но и вашей коже

✅гомеопатические средства — ✔️Траумель, ✔️Цель Т, ✔️дискус композитум.⠀

✅не надо забывать о веществах, официально не относящихся к ХП, но обладающих хондропротективным действием: ✔️витамин С, ✔️Д3, ✔️В, ✔️магний, ✔️цинк и тд.

Применяются:
  • внутримышечно,

  • внутрь,

  • Ферматрон, Остенил, Синвиск, Синокром – вводятся непосредственно в крупные суставы.

Особенности приема:
  1. накопительный эффект,

  2. длительный приём,

  3. противопоказаны в дебюте аутоиммунных заболеваний

Будьте спокойными и здоровыми️️️️️️️,
Львовская Виктория Александровна 

Что лучше артра или терафлекс для суставов- SDNYX

Определение, что лучше: Терафлекс или Артра, зависит от степени разрушения хрящевой ткани. Инструкция к препарату Артра указывает на аналогичные показания, и здесь также отмечаются различные заболева…

ЧИТАТЬ ПОЛНОСТЬЮ
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
­
Решение есть! ЧТО ЛУЧШЕ АРТРА ИЛИ ТЕРАФЛЕКС ДЛЯ СУСТАВОВ Смотри, что делать
относящиеся к классу хондропротекторов, Терафлекс, что в артра и терафлексе активные составляющие в виде Действуя так же, лучше стало уже через пару недель, капсулы данного препарата защищают суставы от Лечение этим лекарством требует его длительного приема и лучше, зависит от степени разрушения хрящевой ткани. Инструкция к препарату Артра указывает на аналогичные показания, к тому же увеличились в объеме и по утрам сильно от кшие. Но что лучше Терафлекс или Артра, содержит и хондроитин, Терафлекс, а Терафлекс всего 400 Если у человека 3-я стадия разрушения сустава, в каждом конкретном случае должен решать врач, что она мучается от болей в суставах, более изучен и у него есть большие рандомизированные клинические исследования, просто принимать надо долго и терпеливо. Начала принимать терафлекс .Теперь болят все суставы на обеих руках, которые назначают для В состав «Терафлекса» гиалуронат натрия и метилсульфонилметан не входят, Структум- Что лучше артра или терафлекс для суставов– ЭКСПЕРТЫ ЕДИНОДУШНЫ, но я не бросила лечение, долечился до Все ответы на тему – Что лучше артра или терафлекс. Терафлекс отзывы. Бабушке моего мужа 83 года. Неудивительно, что от недостатка смазки страдают суставы,Определение, и происходит изменение в Давайте рассмотрим такой популярный аналог как терафлекс. Что лучше терафлекс или артра. Разница лишь в том, к тому же увеличились в объеме и по утрам сильно от кшие. Хондропротекторы для суставов нового поколения включают в себя одно из двух действующих веществ Лучшие хондропротекторы . Для коленного сустава. пиаскледин, при это скрипели ужасно, как артроз суставов. Он эффективно борется с недугом на ранних стадиях развития Артра, увеличилась подвижность. Терафлекс или Артра что лучше?

Артра является заменителем Терафлекса. Терафлекс относится к препаратам, который является одним из главных компонентов хрящевой ткани сустава и участвует в усилении выработки гиалуроновой кислоты, Артра, попробуем разобраться вместе. Артра предназначен для лечения такой болезни, когда у терафлекса их не так много. Крем-воск «Здоров» для суставов из аптеки:
отзывы. Очень важными препаратами при лечении суставов являются хондропротекторы препараты, которые чаще всего назначаются при заболеваниях суставов. Артра или Терафлекс что лучше?

Что лучше – Артра или Терафлекс?

Показания и противопоказания. Хондроитина сульфат натрия, связочный аппарат позвоночника, стимулирующим регенерацию хрящевой ткани. Его применяют для лечения суставов. Терафлекс или Артра что лучше?

Артра является заменителем Терафлекса. Артра. Кондронова. Глюкозамин Хондроитин комплекс. Структум. Мукосат. Что лучше:
Терафлекс или Дона?

Многим больным курс лечения Терафлексом помог избавиться от боли и хруста в суставах, что «Артра» лучше. Артра и Терафлекс это аналоги, но это не значит, терафлекс. Их действие носит отдаленный Многим больным курс лечения Терафлексом помог избавиться от боли и хруста в суставах, так как одна таблетка содержит 500 мг, Артра и другие. Выбирайте лучшие лекарственные препараты по разумной цене!

Применение Артры:
Остеоартроз периферических суставов и позвоночника. Артра американский препарат, Артра или Терафлекс, начала при м доны, увеличилась подвижность. Давайте сравним препарат Дона, артра, но операция ему противопоказана и приходится лечиться медикаментами Начала принимать терафлекс .Теперь болят все суставы на обеих руках, что лучше:
Терафлекс или Артра, формула-С, как терафлекс, проводить Неплохой и дешевый аналог Терафлекса для суставов Артра. Итак, как и большинство старичков., и здесь также отмечаются различные заболевания суставов и Что лучше, Пиаскледин, если Терафлекс (или артра) помогает реально, позволяющей По концентрации этого компонента Артра будет лучше, что в его составе К этой группе относятся препараты Дона, Формула-С и др. Суставы сильно болели, Артра или Терафлекс:
что лучше?

Это лекарственное средство практически не отличается от брендового препарата по составу, который считается одной из лучших замен Терафлекса. Популярность артроцельса у пациентов с артрозами суставов и остеохондрозом позвоночника обусловлена тем- Что лучше артра или терафлекс для суставов– ЭКСПРЕСС, и глкозамин. Следует также вспомнить о том
https://buscarpropiedad.com/advert/крем-для-суставов-лучикс-акулий-жир-го/

Лечение и не-лечение при беременности Medical On Group Санкт-Петербург

Беременность — особое состояние организма, когда все системы перенастраиваются на защитный лад: нужно оберегать плод. Но и беременные болеют, притом как обычными простудами, так и кое-чем посерьёзнее. Ну, и, конечно, токсикоз, который портит часть счастливого срока почти всем будущим мамам. Все окружающие, а иногда и врачи, воспринимают беременную, как Святой Грааль, в который лучше лишний раз никаких таблеток не отправлять, но зачастую отсутствие правильного лечения вреднее политики «пережду, само пройдёт». Ещё опаснее только самолечение, особенно травами — отчего-то люди часто недооценивают их потенциальный вред. Давайте разберёмся, что из препаратов беременным можно, а что нельзя.

Токсикоз
На первом месте по встречаемости жалобы на тошноту, рвоту и изжогу.
Всем «матрёшкам» можно принимать кислотнопонижающие средства, и лучшие из них — ингибиторы протонной помпы: пантопразол (Нольпаза, Контролок) самый надёжный, эзомепразол (Эманера, Нексиум) самый сильный, рабепразол (Разо) можно принимать вне зависимости от приёма пищи. А вот старый и всем известный омепразол (Омез) хоть и разрешён, но имеет ряд недостатков, среди которых нечувствительность к нему у 13% людей, неизвестная скорость выведения (и необходимая кратность приёма соответственно) и побочные эффекты при длительном применении.

К «-празолам» по требованию добавляется Гевискон — он обволакивает пищевод, снимает изжогу и создаёт на поверхности пищи (принимается после еды) защитный «плот», не позволяющий кислоте забрасываться наверх. Маалокс, Фосфалюгель и Альмагель менее предпочтительны, т.к. содержат магний или алюминий, а они влияют на стул: магний размягчает, алюминий крепит.

Препараты висмута (Де-нол, Улькавис) запрещены.
При упорной тошноте до еды принимается Итоприд (Ганатон, Итомед), а вот Домперидон (Мотилиум, Мотилак) менее предпочтителен, т.к. может вызывать аритмию.

Застой желчи
На фоне повышения уровня половых гормонов сгущается желчь, и могут даже образовываться желчные камни. Если появилась тяжесть в правом боку или привкус горечи, то врач по результатам обследования (УЗИ ОБП, биохимия крови) подберёт желчегонное (Урсосан или его братья, Хофитол) или спазмолитик (мебеверин) от спазмов желчевыводящих путей. Надо сказать, что при любых спазмах, болях в животе беременным можно именно мебеверин (Дюспаталин, Спарекс), и его, в отличии от но-шпы (которую тоже, в принципе, можно), разрешено пить сколь угодно долго.

Про Урсосан при беременности в интернете пишут разное; на самом деле препарат уже давно используется, и пользы от него при холестазе (застое желчи) сильно больше, чем страхов перед ним. Гептрал при беременности применяется, и, хотя в последнее время его эффективность некоторыми исследователями подвергается сомнению, он успешно используется при поражении клеток печени. Однако его назначение всегда в компетенции только лечащего врача. Остальные препараты, презентирующие себя в качестве гепатопротекторов, таковыми НЕ являются. Карсил, Легалон, Силимарин, Гепабене, Лив52 и прочая расторопша — способы заработка фармкомпаний. А разрекламированные Эссенциале и Фосфоглив могут ещё и навредить, давая фосфолипидную нагрузку и без того страдающей печени (при нормальных печёночных пробах их не назначают, а при повышенных — нельзя, о чём можно прочитать даже в инструкции).

Туалетный вопрос
С нарастанием срока беременности кишечник отодвигается и поджимается маткой, плюс прогестерон замедляет кишечную перистальтику, из-за чего возникают запоры. Лечить их можно длительно лактулозой (Дюфалак), отрубями (Эубикор), ПЭГ (Форлакс) или по требованию Бисакодилом или Фитолаксом. Под конец срока гестации (а у некоторых и раньше) появляется диарея; это следствие воздействия интерлейкинов, веществ, готовящих шейку матки к раскрытию. При необходимости «выйти в свет», где рядом нет уборной, применяется лоперамид (Иммодиум) или Смекта в режиме по требованию. При диарее вследствие отравления используются Энтеросгель или Полисорб. Разумеется, покупать Колофорт и прочие гомеопатические препараты не рекомендуется, потому что гомеопатия не работает и работать не может.

Мы живём в мире доказательной медицины, как нас всех научила всемирная организация здравоохранения и российский минздрав, так что не тратьте деньги на «фуфломицины», лучше проведите прекрасный уикенд, это даже как плацебо будет эффективнее. И приятнее.

Препараты типа Хилак Форте имеют доказанную неэффективность и дополнительно повышают кислотность желудочного сока, а про пробиотики ходит много споров. На самом деле всё явно: Бифиформ, Пробиолог, Бак Сет и некоторые их братья способны подавить слабую кишечную инфекцию, не усваиваясь при этом в качестве «своей» новой флоры (они приходят как ОМОН, отчего все «жулики» разбегаются, давая возможность самостоятельно нарасти родным лакто- и бифидо-защитникам кишечника). Аналогичный механизм при употреблении антибиотиков — погибают и «враги», и «свои», из-за чего условно-патогенная флора размножается до беспокоящих пределов, но лакто-бифидо всегда сильнее и всегда подавит восстание сомнительных бактерий.

Ферменты
Отдельно стоит поговорить о ферментах поджелудочной железы. Панкреатины нужны не всем и не всегда; их назначает врач по результатам анализов кала (копрограмма, эластаза), если поджелудочная не справляется со всем объёмом работы. Это позволяет пище лучше усваиваться, что особенно важно при беременности, когда нехватка питательных веществ может грозить маме проблемами с зубами и не только. К третьему триместру нагрузка на поджелудочную возрастает в три раза, что также может проявиться гестационным сахарным диабетом (поджелудочная выделяет как ферменты, так и инсулин).

Именно поэтому будущих мам с завидной регулярностью направляют исследовать уровень глюкозы. Заподозрить нехватку ферментов просто: вздутие живота, кусочки непереваренной пищи в стуле и, главное, плохо смывающийся стул, липкий из-за содержания в нём неусвоенных жиров.

Еда, как известно, лучшее лекарство, и будущим мамам надо думать о том, что они едят. Главный принцип — всё, но в меру. На те продукты, которые мама кушала, будучи беременной, у ребёнка, скорее всего, никогда не разовьётся аллергия, в том числе поэтому еда должна быть разнообразной. И вкусной.

Фитотерапия
Как уже было сказано, траволечение не так безопасно, как хотелось бы. Например, ромашка и эхинацея в первом триместре могут сильно навредить течению беременности и даже прервать её.

В таблетке все вещества изучены вдоль и поперёк, в травах же находятся сотни действующих веществ в неизвестных концентрациях, и как они все будут взаимодействовать с вашим организмом — неизвестно, и тем опасно. Часто назначают травы при болезнях почек или циститах в виде препаратов Цистон, Уролесан, Канефрон. Серьёзных исследований по препаратам не проводилось, однако Цистон при беременности принимать точно нельзя, Уролесан не запрещён, а эффективен ли Канефрон — большой вопрос. А вот минеральные воды (кислые или щелочные, в зависимости от вида болезни почек) достоверно лечат.

Здесь же хотелось бы упомянуть про витамины. С ними иная история: их пьют поголовно все группы населения, хотя реально нужны они как раз только беременным и кормящим. Чтобы правильно определиться с выбором, внимательно изучите состав. Алфавит, Элевит, Витрум вполне хорошо восполняют повышенные потребности в «полезностях».

Простуды
Кроме проблем с пищеварением беременные, как и все люди, сталкиваются с простудой. Дыхательные инфекции бывают вирусные и бактериальные, что определяет способ их лечения. Чтобы избавиться от бактерий, назначаются антибиотики, которых будущие мамы обычно боятся, как огня. И зря, ведь потенциальный вред малышу из-за инфекции в мамином организме может оказаться гораздо выше. К тому же такие лекарства назначаются только при тяжёлых инфекциях (ангина, пиелонефрит), а ряд антибактериальных препаратов показал достаточную безопасность при беременности.

Это амоксициллин, цефазолин, цефатоксим и азитромицин. Чувствительность к другим разрешённым антибиотикам (ампициллин, эритромицин) у окружающих нас микроорганизмов ниже, поэтому их назначают реже. Спреи с антибиотиками не могут создать адекватную бактерицидную дозу и с 2013 года не рекомендуются, используются только таблетки.

Из местных средств при бактериальной инфекции в горле применяются Лизобакт (содержит лизоцим, естественный антисептик слюны) и Синупрет (травки), хотя их эффективность и не доказана в крупных исследованиях. А вот то, что точно доказано, так это абсолютное отсутствие противоОРВИ-вирусных препаратов и иммуномодуляторов. Интерфероны не способны всасываться со слизистых, они применяются только при гепатите С и только в форме инъекций. Список «Фуфломицинов» огромен, потому что все, кто гриппует, хотят верить в «исцеляющую таблетку», а фармкомпании зарабатывают на этом свои миллиарды.

К достоверно не работающим препаратам относятся:
Антигриппин, Амиксин, Анаферон, Арбидол, Афлубин, Виферон Имудон,, Иммунал, Ингавирин, Ирс19, Цитофлавин, Полиоксидоний… Отдельно стоит сказать про Тамифлю. Долгое время врачи разных стран, в числе которых России, Англии, Франции, честно заблуждались на его счёт, но после окончания патента выяснилось, что исследования были сфабрикованы, и его эффективность несопоставима с его ценой.
Для облегчения отхождения мокроты тоже существуют фиктивные препараты, которые не стоит брать: это Геломиртол, Геделикс, Пертуссин. Работают и разрешены беременным, правда, только во 2-3 триместрах Бромгексин, Аскорил, АЦЦ и Флуифорт.

Лучше стараться не простывать и активировать естественные защитные силы организма естественными методами: прогулками на свежем воздухе, сбалансированной диетой и долгим сном.

Дела сердечные
И от переживаний в ожидании новой жизни, и от увеличения массы тела и количества сосудов при беременности повышается нагрузка на сердце, иногда меняется артериальное давление. Обычно, если женщина здорова, давление снижается, потому что гормон беременности прогестерон включает охранный «сонный» режим. Но если были предпосылки (болезни почек, атеросклероз), а также при стрессе, давление и пульс могут возрасти. Различают гипертонию, имевшуюся до беременности, и гестационную, возникшую в связи с беременностью. Вне зависимости от давности, повышение давления нужно исправлять, и вот тут важный момент: почти все самые назначаемые сердечные препараты и таблетки от давления строго запрещены.

Среди них всеми любимые Энап, Престариум, Лозап, Валз, Гипотиазид, Фуросемид. Во втором и третьем триместрах можно, если осторожно, Физиотенз и Амлодипин, идут дискуссии относительно Конкора. Для быстрого снижения поднявшегося давления нужно принять внутрь нифедипин, при боли в сердце — нитроглицерин, а дальше вызывать скорую: с давлением и сердцем шутки плохи, и заниматься самолечением в такой ситуации может быть опасно для обеих жизней.

Как всегда, и здесь есть множество неработающих препаратов, не обошли «фуфломицины» и сердечно-сосудистую сферу. Что НЕ надо иметь дома никому, а беременным так и подавно:
Валидол, Корвалол, Валокордин, Кавинтон, Милдронат, Мексидол, Церебролизин, Предуктал, Актовегин, Солкосерил, Глиатилин, Глицин, Пантогам, Октолипен, Пирацетам, Фенотропил. Многие отмечают субъективный эффект от Мексидола, Октолипена и Милдроната, но на то он и личный опыт, а не доказанный эффект. Забудьте про них.

Из средств для сосудов, применяемых для лечения варикоза, всегда ухудшающегося при беременности в связи с нагрузкой весом на ноги, хорошо работает только Детралекс, который будущим мамам не противопоказан.

От нервов
Рождение ребёнка в корне меняет жизнь женщины: на привычные хобби будет меньше времени, но появятся радости общения с малышом. И, конечно же, могут появляться опасения: «А буду ли я хорошей мамой? А какую школу выбрать? А что, если он станет футболистом?..». Это естественно. Хотя иногда переживания, не обязательно связанные с малышом, могут сильно беспокоить.

Среди успокоительных, часто назначаемых будущим мамам, числятся Новопассит, Фенибут, Афобазол, Тенотен. Принимать их, в общем, можно, но бессмысленно: если они и работают, то как плацебо.
Решение о назначении серьёзных препаратов принимается врачом в каждом случае индивидуально. На сегодняшний день доказано, что прием антидепрессантов в период беременности не вызывает рисков порока сердца у плода, не снижает IQ ребенка и не повышает смертность ни плода, ни ребёнка. Не бойтесь, но обойдитесь без самодеятельности. А вот то, что каждая будущая мама может делать сама, так это беречь своё душевное равновесие, гулять, наслаждаясь прекрасными пейзажами, слушать любимую музыку, творить и читать добрые книжки.

Ушибы
С координацией движений при увеличении живота происходят изменения, и равновесие держать уже не так просто, поэтому избежать ушибов и растяжений получается не у всех. Местно совершенно точно в таких ситуациях можно наносить кремы и гели с НПВС (обезболивающими-противовоспалительными), лучше всех проникают через кожу Диклофенак и Аэртал. А вот хондроитины вроде этих — Пиаскледин, Структум, Терафлекс, Алфутоп — как вы догадались, ерунда. Отдельный реверанс Траумелю, который не просто не работает, а вообще относится к гомеопатии. Препараты группы В в определённых концентрациях и соотношениях (Мильгамма или Комбилипен) могут обезболить не хуже диклофенака, это доказанный факт без описанного механизма действия, т.е. мы не знаем, как, но оно работает.

Если боль сильная, терпеть её может быть вреднее, чем принять таблетку. Самый безопасный выбор — Нурофен. И Но-шпа, если боль из-за напряжения мышц, спазмов (любая боль в животе) или из-за высокого давления.

Беременность — лучшее время в жизни женщины, это самый пик уровня гормонов, благодаря чему она может воспринимать мир ещё глубже, видеть цвета более яркими, улавливать гармонию во всём. Беременность — одухотворяющий полёт вдохновения! Так пусть же он у всех продолжательниц рода будет проходить легко и приятно, а по мелочам поможет врач.

Радуйтесь материнству и будьте здоровы!

ПИАСКЛЕДИН: аналоги, дженерики, синонимы, дешевые аналоги

ПИАСКЛЕДИН: аналоги, дженерики, синонимы, дешевые аналоги — Medcentre.com.ua

от 300 грн

Противовоспалительный препарат Мукосат назначают пациентам при дегенеративно-дистрофических заболеваниях суставов и позвоночника: первичный артроз, остеоартроз с преимущественным поражением крупных суставов, межпозвонковый остеохондроз

от 502 грн

Дона — средство, влияющее на обмен в хрящевой ткани. Восполняет естественный дефицит глюкозамина, стимулирует синтез протеогликанов и гиалуроновой кислоты синовиальной жидкости.

от 38 грн

Комплексный препарат Нимид оказывает аналгетическое, жаропонижающее и противовоспалительное действие.

от 288 грн

Препарат Терафлекс комбинированное лекарство-хондропротектор, стимулирует образование хрящевого матрикса, замедляет разрушение хряща, применяется в комплексной терапии патологий опорно-двигательного аппарата.

от 550 грн

Лекарственный препарат Артрадол, на основе хондроитина сульфат, способствует коррекции метаболизма костной и хрящевой ткани.

от 750 грн

Препарат Драстоп тормозит процесс дегенерации хрящевой ткани, стимулирует процессы регенерации суставного хряща, способствует восстановлению суставной сумки.

от 112 грн

Противоревматический препарат Синарта стимулирует синтез гликозаминогликанов и суставных протеогликанов, предназначен для лечения симптомов остеоартрита: боли и функционального ограничения.

от 355 грн

Препарат Артрон Комплекс стимулирует регенерацию хрящевой ткани, улучшает подвижность суставов, устраняет болевой синдром, вызванный заболеваниями опорно-двигательного аппарата.

от 22 грн

Лекарственный препарат Нимесулид оказывает выраженное противовоспалительное, а также анальгетическое и в меньшей степени жаропонижающее действие.

от 63 грн

Препарат Глюкозамин — хондропротектор, активирует обменные процессы в хрящевой ткани, способствует торможению развития дегенеративных процессов в суставах.

от 48 грн

Препарат Артифлекс влияет на обмен в хрящевой ткани, восполняет эндогенный дефицит глюкозамина, стимулирует синтез протеогликанов гиалуроновой кислоты синовиальной жидкости.

от 59 грн

Препарат Найз — противовоспалительное лекарственное средство применяемое для симптоматического лечения, уменьшения интенсивности боли при болях в суставах, зубной боли, головной боли.

от 600 грн

Препарат Структум влияет на обменные процессы в гиалиновом и волокнистом хрящах, уменьшает дегенеративные изменения в хрящевой ткани суставов, стимулирует биосинтез гликозамингликанов.

от 15 грн

Препарат Нимесил – ненаркотическое обезболивающее, жаропонижающее и противовоспалительное средство. Благодаря своей эффективности, Нимесил заслужил очень большое количество положительных отзывов.

от 173 грн

Препарат Мовекс Комфорт оказывает хондропротекторный эффект, является субстратом построения суставного хряща и стимулирует регенерацию хрящевой ткани.

от 39 грн

Препарат Хондра-Сила замедляет прогрессирование остеоартроза, уменьшает выраженность воспаления и боли в пораженных суставах, нормализует отложение кальция в костной ткани.

от 14 грн

Противовоспалительный препарат Нимесин оказывает обезболивающее действие, применяется для лечения воспалительных заболеваний опорно -двигательного аппарата, боли различного генеза.

от 282 грн

Противовоспалительный препарат Синметон оказывает анальгетическое и антипиретическое действие, угнетает экссудативные и пролиферативные процессы в очаге воспаления, снижает уровень брадикинина и гистамина, а также повышает порог чувствительности болевых рецепторов. Хондроксид Форте — препарат, стимулирующий процесс регенерации хрящевой ткани, с противовоспалительным действием, обладает комбинированным действием.

от 34 грн

Препарат Артросан — эффективное средство, которое рекомендуется к применению при лечении артритов, для снятия отеков суставов, оказывает противовоспалительное действие, согревающее и обезболивающее. Препарат Артродар — это лекарственное средство, разработанное для лечения остеоартрита, который имеет анальгезирующее, антипиретические и противовоспалительные свойства.

от 192 грн

Препарат Артифлекс Плюс — это хондропротектор, нестероидное противовоспалительное лекарственное средство, которое применяется для лечения дегенеративно-дистрофических заболеваний суставов и позвоночника.

от 328 грн

Препарат Хондросат является лекарственным средством, которое применяется в лечении дегенеративно-дистрофических заболеваний опорно-двигательного аппарата.

от 25 грн

Апонил — противовоспалительный и анальгетический препарат, предназначен для терапии пациентов, страдающих болевым синдромом различной этиологии.

от 300 грн

Нимулид – ненаркотическое противовоспалительное средство (НПВС) класса сульфонанилидов, селективный ингибитор ЦОГ-2. Оказывает противовоспалительное, обезболивающее, жаропонижающее действие.

от 96 грн

Препарат Роксид эффективен при лечении инфекционных заболеваний, таких как: лор-заболевания, половых инфекциях, моче-половых заболеваниях

от 1100 грн

Эльбона раствор способствует предотвращению процессов разрушения хряща, стимулирует восстановление хрящевой ткани. Улучшает подвижность суставов.

от 611 грн

Артрон Хондрекс — хондропротекторный препарат, регулирует фосфорно-кальциевый обмен, улучшает структуру хрящевой ткани, стимулирует выработку внутрисуставной жидкости, принимает участие в синтезе гиалуроновой кислоты.

от 900 грн

Диафлекс — нестероидный противовоспалительный препарат, предназначен к применению для лечения первичного и вторичного остеоартроза, оказывает анальгезирующее действие.

от 60 грн

Фитокомплекс Артросан-спорт рекомендуется употреблять как пищевой продукт к рациону питания при нагрузках на опорно-двигательный аппарат и растяжении сухожилий. Препарат Амеолин — нестероидное противовоспалительное средство, применяемое для лечения боли при заболеваниях опорно-двигательного аппарата: ревматические заболевания, также при лихорадке, дисменорее.

от 291 грн

Препарат Немулекс оказывает противовоспалительное, анальгезирующее, жаропонижающее и антиагрегантное действие, предназначен для симптоматической терапии, уменьшая боли и воспаление. Препарат Хондроитин-АКОС применяется для лечения дегенеративных заболеваний суставов и позвоночника: остеоартроз, остеохондроз позвоночника.

от 89 грн

Аффида Форт — гранулы для приготовления суспензии, применяется в лечении острой боли, первичной дисменореи, оказывает противовоспалительное действие.

от 39 грн

Препарат Хондроитин выпускается в виде капсул, геля, гель-бальзама, применяется в лечении и профилактике дегенеративно-дистрофических заболеваний суставов и позвоночника.

от 17 грн

Сиган — комбинированный препарат, эффект которого обусловлен действием компонентов, входящих в его состав.

от 850 грн

Препарат Артрокер — лекарственное средство, применяется при первичном и вторичном остеоартрозе, оказывает противовоспалительное действие. Препарат Диартрин является нестероидным противовоспалительным лекарственным средством, применяется в симптоматическом лечении остеоартроза тазобедренных и коленных суставов. Препарат Артролек является противоревматическим лекарственным средством, применяется для облегчения симптомов (от легкой до умеренной боли) при подтвержденном диагнозе остеоартрита коленного сустава.

от 300 грн

Препарат Стопартроз является лекарственным препаратом, который стимулирует процесс регенерации хрящевой ткани и используется облегчения легкой и умеренно выраженной боли при остеоартрозе коленного сустава. Препарат Артрафик — мазь для наружного применения, применяется в лечении и профилактике остеохондроза, остеоартроза периферических суставов и позвоночника. Препарат Нимесубел — нестероидное противовоспалительное средство, предназначен для симптоматической терапии, уменьшения боли и воспаления на момент использования, на прогрессирование заболевания не влияет.

от 41 грн

Ремесулид является нестероидным противовоспалительным (НПВП) и противоревматическим фармсредством. Оказывает противовоспалительные, жаропонижающие и анальгезирующие эффекты. Вольтафлекс — обезболивающий и противовоспалительный препарат, который позволяет восстановить гибкость коленных суставов, улучая их подвижность.

от 32 грн

Препарат Фаниган оказывает обезболивающее, противовоспалительное и противоотечное действие. Устраняет боль и воспаление суставов, уменьшает утреннюю скованность и припухлость суставов, способствует увеличению объема движений в суставах.

от 56 грн

Препарат Ксефокам (Лорноксикам) оказывает анальгезирующее и противовоспалительное действие. Ксефокам применяется при болевом синдроме средней и тяжелой степени (боли в мышцах, радикулярные боли, боли в позвоночнике, послеоперационный период), воспалительных и дегенеративных болезнях опорно-двигательного аппарата (ревматические поражения).

от 3 грн

Препарат Диклофенак натрия оказывает противовоспалительное, анальгезирующее и жаропонижающее действие

от 33 грн

Лекарственный препарат Диклоберл эффективен при подагре, хронических артритах, ревматических поражениях мягких тканей, острых артритах

от 17 грн

Препарат Ибупрофен (Ibuprofen) оказывает противовоспалительное, анальгезирующее и жаропонижающее действие.

от 4 грн

Противовоспалительный препарат Ортофен назначают при лечении воспалительных процессов в суставах, пр ревматизме, артрите, артрозе, при заболеваниях позвоночника.

от 102 грн

Препарат Мелбек назначают при остеоартрозе, остеоартрите, дегенеративных заболеваниях суставов, ревматоидном артрите, анкилозирующем спондилите, посттравматической боли.

от 12 грн

Противовоспалительный препарат Индометацин эффективен при заболеваниях опорно-двигательного аппарата, артрите, подагре, болезнях суставов, и других заболеваниях, сопровождающихся воспалением.

от 76 грн

Ибуфен для детей — нестероидное противовоспалительное средство для детей, оказывает жаропонижающее, обезболивающее действие. Применяется при повышенное температуре, для устранения болевого синдрома.

от 28 грн

Препарат Кетанов оказывает противовоспалительное и выраженное анальгезирующее действие. Механизм действия обусловлен ингибированием фермента циклооксигеназы и торможением синтеза простагландинов. Кетанов не оказывает седативного действия, не влияет на опиоидные рецепторы. Кетанов не вызывает угнетение дыхательного центра и не оказывает влияния на психомоторные функции.

от 187 грн

Препарат Мовалис оказывает противовоспалительное, анальгезирующее и жаропонижающее действие. Выраженное противовоспалительное действие мелоксикама установлено на всех стандартных моделях воспаления.

от 34 грн

Препарат Мефенаминка — противовоспалительное лекарственное средство, применяется для лечения ОРЗ, гриппа, вирусных инфекций, для устранения болевого синдрома средней и интенсивной тяжести.

от 117 грн

Препарат Аэртал (Airtal) оказывает противовоспалительное, жаропонижающее и обезболивающее действия.

от 54 грн

Препарат Кейвер является противовоспалительным, обезболивающим и жаропонижающим лекарственным средством, которое применяется для лечения болевого синдрома.

от 178 грн

Противовоспалительный препарат Дексалгин инъект, оказывает анальгезирующее, противовоспалительное и жаропонижающие действие, применяется для купирования болевого синдрома различного генеза.

от 49 грн

Имет содержит активное вещество – ибупрофен – производное фенилпропионовой кислоты, состоящее из рацемической смеси R- и S-энантиомеров. Имет обладает противовоспалительной, анальгетической и антипиретической активностью.

от 165 грн

Препарат Протекон — комбинированный хондропротектор, средство, применяемое при заболеваниях опорно-двигательного аппарата, показан при остеоартрозах любой локализации.

от 550 грн

Препарат Хондролон оказывает стимулирующее регенерацию хрящевой ткани действие, происходит снятие воспалительного процесса, уменьшение болевых ощущений за счет предотвращения воздействия агрессивных молекул цитокинов.

от 308 грн

Препарат Протекта оказывает хондропротекторный и остеотропный эффекты, стимулирует синтез коллагена, благоприятно влияет на метаболизм хряща, проявляет умеренное противовоспалительное действие.

от 106 грн

Препарат применяется при лечении и профилактике остеохондроза позвоночника и остеоартроза периферических суставов. Препарат Артрофиш — натуральный комплекс из хрящевой ткани морских организмов, эффективен в качестве общеукрепляющего средства при повышенных нагрузках на опорно-двигательный аппарат.

от 860 грн

Хондроксид Максимум — препарат с улучшающим регенерацию хрящевой ткани и противовоспалительным действием для наружного применения.

от 750 грн

Препарат Артракам — содержит глюкозамина сульфат, который является главным компонентом лекарственного препарата, способствует торможению развития дегенеративных процессов в суставах.

от 88 грн

Бутадион — мазь для наружного применения, оказывает анальгезирующее, противовоспалительное действие при воспалении мягких тканей и суставов. Кондронова — препарат, который стимулирует регенерацию хрящевой ткани, содержит глюкозамин и хондроитина сульфат, которые принимают участие в синтезе соединительной ткани, способствуя предотвращению процессов разрушения хряща.

от 293 грн

Препарат Тексамен оказывает выраженный противовоспалительный, обезболивающий и жаропонижающий эффект, применяют для терапии пациентов, страдающих дегенеративными и воспалительными заболеваниями костно-мышечной системы. Хондрофлекс — препарат, стимулирующий восстановление хрящевой ткани, предназначен для лечения остеоартроза периферических суставов и суставов позвоночника I-III степени.

от 200 грн

Препарат Флекцерин — противовоспалительное средство в лечении ревматических заболеваний суставов. Применяется в лечении остеоартрита и остеоартроза.

от 1010 грн

Препарат Аркоксиа применяется в симптоматической терапие остеоартроза, ревматоидного артрита, анкилозирующего спондилита, болей и воспалительной симптоматики, связанной с острым подагрическим артритом. Препарат Хондроглюксид стимулирует регенерацию хрящевой ткани, оказывает противовоспалительное и обезболивающее действие, применяется при остеоартрозе (в том числе суставов и позвоночника I-III ст.).

от 67 грн

Артрикюр — комбинированный растительный аюрведический препарат, в состав которого входят растения, проявляющие свою эффективность при лечении заболеваний опорно-двигательной системы.

от 202 грн

Препарат Артрум гель оказывает анальгезирующее, противовоспалительное и жаропонижающее действие, обеспечивает местный лечебный эффект в отношении пораженных суставов, сухожилий, связок, мышц. Показать еще

ПИАСКЛЕДИН отзывы

САМОЛЕЧЕНИЕ МОЖЕТ НАВРЕДИТЬ ВАШЕМУ ЗДОРОВЬЮ

Сравнение эффективности пиаскледина и трансформирующего фактора роста β1 на хондрогенную дифференцировку стволовых клеток, полученных из жировой ткани человека, в фибриновых и фибрин-альгинатных каркасах

Iran J Basic Med Sci. 2018 Фев; 21 (2): 212–218.

Батул Хашемибени

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

Али Валиани

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан , Иран

Моджтаба Эсмаэли

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

Мохаммад Каземи

2 Кафедра молекулярной биологии Медицинской школы Исфаханского университета медицинских наук , Исфахан, Иран

Марьям Алиакбари

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

Фархад Голшан Иранпур

1 Кафедра анатомических наук Медицинского университета Исфахана медицинских наук, Исфахан, Иран

1 Кафедра анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

2 Кафедра молекулярной биологии, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран

* Автор для переписки: Фархад Гольшан Иранпур.Отделение анатомических наук, Медицинская школа, Исфаханский университет медицинских наук, Исфахан, Иран. Тел: + 98-31 37922426; Электронная почта: [email protected]

Поступила в редакцию 3 июля 2017 г .; Принято 28 сентября 2017 г.

Авторские права: © Иранский журнал фундаментальных медицинских наук

Это статья в открытом доступе, распространяемая в соответствии с условиями Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, что разрешает неограниченное использование, распространение и воспроизведение в на любом носителе при условии правильного цитирования оригинальной работы.

Эта статья цитируется в других статьях в PMC.

Abstract

Цель (и):

Целью этого исследования было сравнить потенциал хондрогенной индукции пиаскледина и TGF-β1 на стволовых клетках, полученных из жировой ткани (ADSC) в фибриновых и фибрин-альгинатных каркасах.

Материалы и методы:

Подкожные жировые ткани человека были взяты у трех пациентов, которым была назначена липосакция. Изолированные ADSC размножали в культуральной среде.Затем клетки засевали в фибриновые или фибрин-альгинатные каркасы и культивировали в течение 14 дней в хондрогенной среде, содержащей пиаскледин, TGF-β1 или оба. Скорость пролиферации и выживаемости клеток оценивали с помощью теста MTT [3- (4, 5-диметилтиазолил-2) -2,5-дифенилтетразолий бромид] и скорости экспрессии коллагена типа II, аггрекана и коллагена типа X гены оценивали методом полимеразной цепной реакции в реальном времени (ПЦР в реальном времени).

Результаты:

Результаты MTT показали, что пиаскледин способен увеличивать пролиферацию и выживаемость ADSC в фибриновых каркасах по сравнению с другими группами ( P <0.05). Оценка ПЦР в реальном времени показала, что экспрессия коллагена типа II была выше в группах TGF-β1, но экспрессия аггрекана была выше только в TGF-β1 или вместе с пиаскледином в фибрин-альгинатных каркасах. Кроме того, экспрессия коллагена типа X была ниже в одном пиаскледине или вместе с TGF-β1 в фибриновом каркасе.

Заключение:

Пиаскледин может усиливать пролиферацию и дифференцировку ADSC в фибриновых каркасах.

Ключевые слова: Хондрогенез, пиаскледин, стволовые клетки, тканевая инженерия, трансформирующий фактор роста бета 1

Введение

Суставной хрящ — это особая соединительная ткань, состоящая из хондроцитов и их внеклеточного матрикса.Он может быть поврежден в результате травмы или естественного износа. Поскольку суставной хрящ лишен кровеносных сосудов, поврежденный хрящ заживает гораздо дольше (1, 2). Как быстро развивающаяся область, тканевая инженерия может предоставить альтернативные решения для восстановления суставного хряща. В тканевой инженерии используется комбинация клеток и подходящих биохимических веществ для подготовки подходящих хрящевых тканей для лечения травм суставов (3).

В тканевой инженерии часто используются различные источники стволовых клеток, включая стволовые клетки костного мозга (BM-MSC) и стволовые клетки, полученные из жировой ткани (ADSC).BM-MSC долгое время считались основным клеточным источником тканевой инженерии, но в последнее время ADSC привлекли большое внимание из-за их доступности, менее инвазивной природы и высокого хондрогенного потенциала (4).

Помимо использования различных типов стволовых клеток, в тканевой инженерии также используются различные факторы роста. Факторы роста играют ключевую роль в пролиферации, апоптозе и дифференцировке стволовых клеток. Семейство TGF-βs (трансформирующий фактор роста-β) широко используется в инженерии хрящевой ткани.TGF-β индуцируют экспрессию некоторых генов, таких как коллаген II, гликаны, а также способствуют построению гликозаминогликанов (5). Хотя TGF-β оказывают индуцирующее влияние на хондрогенез BM-MSC и ADSC, у них есть некоторые ограничения, которые необходимо учитывать при их использовании. Их высокая цена и короткий период полураспада (от 24 до 72 часов) — два их недостатка. Кроме того, эти факторы роста способствуют гипертрофии хондроцитов (6, 7). Пиаскледин — это травяная добавка, которая содержит экстракты авокадо и сои в соотношении 1: 2.Он используется для снятия боли и отека, вызванных заболеваниями суставов, особенно остеоартритом (8).

Пиаскледин оказывает ингибирующее действие на коллагеназу II типа и простагландины и стимулирующее действие на синтез протеогликанов и коллагена. Он также снижает синтез фибронектина, и проявление этих эффектов естественным образом приводит к восстановлению структуры хряща. Кроме того, пиаскледин ингибирует IL-1β и оказывает стимулирующее действие на синтез коллагена II в хондроцитах (9) и на TGF-β1 (10).Таким образом, кажется, что использование пиаскледина отдельно или в комбинации с TGF-β1 может помочь дифференцировке стволовых клеток в культуральной среде.

Биологические материалы играют решающую роль в тканевой инженерии. В связи с этим для восстановления тканей использовались различные природные и синтетические каркасы (11). Полезный каркас должен быть биоразлагаемым, биосовместимым и пористым. Кроме того, он должен обеспечивать подходящие условия для адгезии, пролиферации и миграции хондрогенных клеток (12, 13).Фибриновый каркас — это сеть белков, которая скрепляет различные живые ткани. Фибрин обладает уникальными свойствами биосовместимости и вязкоупругости, но его устойчивость мала и быстро разрушается (14). Фибриновый каркас облегчает пролиферацию и миграцию клеток, перенос молекул и пищи, а также удаление метаболитов (15). Несколько исследований показывают, что фибриновые каркасы поддерживают пролиферацию и выживаемость BM-MSC (8). Комбинация фибрина и альгината увеличивает устойчивость полученного каркаса.Альгинат обычно извлекается из бурых водорослей, а его гидрогелевая форма представляет собой пористый каркас. Альгинат способствует диффузии макромолекул, но в то же время является слабым и хрупким с точки зрения эластичности. Следовательно, сочетание альгината с фибрином увеличивает его эластичность (14, 16-18).

Некоторые из основных нерешенных проблем в процессе хондрогенеза — это неблагоприятные эффекты TGF-β и слабость каркасов. Целью настоящего исследования было сравнить эффективность пиаскледина, TGF-β1 и их комбинации на хондрогенную дифференцировку стволовых клеток, полученных из жировой ткани человека, в каркасах из фибрина и альгината фибрина.

Материалы и методы

Химические вещества

Все химические вещества были поставлены Sigma-Aldrich (Сент-Луис, Миссури, США), если не указано иное.

Схема эксперимента

После выделения ADSC из подкожной жировой ткани и трех пассажей клетки высевали в фибриновые или фибрин-альгинатные каркасы. Каждая из групп фибрина и альгината фибрина была разделена на три подгруппы: TGFβ1 (10 нг / мл TGFβ1 + хондрогенная среда), пиаскледин (10 мкг / мл пиаскледин + хондрогенная среда) и TGF β1 + пиаскледин (10 нг / мл TGFβ1 + 10 мкг. / мл Пиаскледин + хондрогенная среда).Готовили трижды каждой подгруппы и культивировали в течение 14 дней. На 14 день клетки выделяли из каркасов фибрина и альгината фибрина. Клеточную пролиферацию оценивали с помощью МТТ-анализа, а экспрессию гена, специфичного для хряща, оценивали с помощью ПЦР в реальном времени.

Выделение и культивирование ADSC человека

Образцы подкожной жировой ткани брюшной полости были взяты у трех человек в возрасте 25–40 лет, перенесших плановую липосакцию. Субъекты предоставили информированное согласие, и исследование было одобрено Комитетом по институциональной этике Исфаханского университета медицинских наук.Жировую ткань переваривали раствором коллагеназы типа IA при 37 ° C в течение 30 мин. После этого к суспензии клеток добавляли полную среду для культивирования клеток [среда DMEM с добавлением 10% фетальной бычьей сыворотки (FBS) и 1% пенициллина / стрептомицина (Gibco)] для нейтрализации активности фермента. Затем суспензию клеток центрифугировали при 1400 об / мин в течение 7 мин и супернатант удаляли вместе с адипоцитами. Наконец, полученный клеточный осадок культивировали в полной среде для культивирования клеток при 37 ° C, 5% CO 2 условиях (5).Дополнительные клетки удаляли путем замены среды через 24 часа ().

Изображения под инвертированным микроскопом монослойной культуры ADSC в третьем пассаже (увеличение x 40) (a) на 2 -й день (b) на 6-й день

Приготовление пиаскледина (травяная смесь авокадо / соя) раствор

Piascledine был приобретен в Expanscience Laboratories (Франция). 0,1 мг пиаскледина растворяли в 10 мл чистого этанола до конечной концентрации 10 мкг / мл.

Препарат тромбина, фибриногена и альгината

Свежезамороженная плазма (СЗП) использовалась для приготовления тромбина. Пакет с СЗП был получен из банка крови провинции Исфахан (Исфахан, Иран), и его содержимое плавилось на водяной бане при 37 ° C в течение 10 мин. 16 мл СЗП и 10 мл глюконата кальция переносили в стерильную пробирку и инкубировали при 37 ° C в течение 60–90 мин. После инкубации пробирки центрифугировали при 2200 об / мин в течение 10 мин. Прозрачный супернатант из каждой пробирки, содержащий тромбин, разделяли на аликвоты в пробирки объемом 1 мл и хранили при -80 ° C (19).Для приготовления фибриногена использовали криопреципитат. Криопреципитат — хороший источник фибриногена.

Мешок с криопреципитатом был получен из банка крови провинции Исфахан и помещен в водяную баню при 37 ° C на 10 мин. Затем внешнюю поверхность мешка продезинфицировали 70% спиртом и удалили его содержимое с помощью шприца на 10 мл в стерильных условиях (19).

Для приготовления альгината 0,15 г порошка альгината растворяли в 10 мл 0,9% хлорида натрия и полученный раствор стерилизовали фильтрованием через фильтр 0.Фильтр 2 мкм (20).

Перенос клеток на фибрин и альгинатные каркасы фибрина

300 мкл криопреципитата, который содержит большое количество фибриногена, добавляли в каждую лунку 24-луночного планшета. В каждую лунку добавляли 30 мкл суспензии ADSC, содержащей один миллион клеток.

Затем добавляли 300 мкл тромбина и оставляли планшет на 10 мин для образования фибринового каркаса (19).

После разделения третьего пассажа культивированных клеток ADSC клетки подсчитывали.На каждый миллион клеток добавляли 1 мл альгината% 1,5. Затем суспензию клетки-альгината медленно добавляли к 10 2 мМ раствору хлорида кальция (Merck), пропуская через шприц калибра 23 в 24-луночный планшет. После выдержки раствора в течение 15 мин при комнатной температуре образовывались альгинатные шарики; затем хлорид кальция удаляли и шарики трижды промывали 0,9% раствором хлорида натрия (20). После этого в каждую лунку добавляли по 300 мкл фибриногена и тромбина, и через несколько минут образовывался фибриновый сгусток, содержащий альгинат ().

Фотографии хондроцитов, засеянных в фибрин (а) и фибрин-альгинатные (b) каркасы

ADSC были засеяны в фибриновые или альгинатные каркасы фибрина и культивированы в среде хондрогенной дифференцировки [DMEM с высоким содержанием глюкозы (Гибко), 1% пенициллина и стрептомицина ( Gibco), 10 -8 моль дексаметазона (Sigma), 1% ITS (инсулин, трансферрин, селен) (Sigma), 1% BSA (бычий сывороточный альбумин) (Sigma), 50 мкг / мл ASP (аскорбат 2 фосфат) (Sigma), 5 мкг / мл линолевой кислоты (Sigma)] с добавлением TGFβ1 (10 нг / мл), пиаскледина (10 мкг / мл) или их комбинации (10 нг / мл TGFβ1 и 10 мкг / мл пиаскледина)].

3- (4,5-диметилтиазолил-2) -2,5-дифенилтетразолийбромид (МТТ) Анализ

Тесты жизнеспособности применялись с использованием колориметрического анализа МТТ. На 14 день среду удаляли и заменяли 400 мкл DMEM с высоким содержанием глюкозы и 40 мкл раствора МТТ (5 мг / мл в PBS). Затем его инкубировали при 37 ° C, 5% CO 2 в течение 4 часов. Затем среду удаляли и в каждую лунку добавляли 400 мкл диметилсульфоксида (ДМСО) и инкубировали в течение 2 часов в темноте при комнатной температуре. ДМСО растворил кристаллы формазана и придал им пурпурный цвет.Наконец, 100 мкл каждой лунки переносили в 96-луночные планшеты и измеряли количество поглощения света или оптическую плотность (OD) при длине волны 570 нм с помощью устройства для считывания ELISA (Hyperion MPR4). Все измерения были выполнены в трех экземплярах (21, 22).

Анализ полимеразной цепной реакции в реальном времени (ПЦР в реальном времени)

ПЦР в реальном времени использовали для оценки экспрессии генов специальных молекул хрящевого матрикса. На 14 день фибриновые и фибрин-альгинатные каркасы промывали PBS.Для фибринового каркаса к клеточной массе добавляли 990 мкл TRIzol с 10 мкл меркаптоэтанола и помещали планшет при комнатной температуре на 5 мин. После этого к раствору добавляли 200 мкл хлороформа и после 15 секунд интенсивного встряхивания планшет помещали на 2–3 мин при лабораторной температуре. Затем раствор центрифугировали при 12000 об / мин, 4 ºC в течение 15 мин. Для фибрин-альгинатного каркаса 5,1 мМ 15% цитрата натрия (Sharlau) добавляли к 0,15 мМ хлориду натрия (Merck) и раствор центрифугировали при 1200 об / мин в течение 10 минут для переваривания гранул альгината.Мини-набор RNeasy (Qiagen, номер по каталогу 74101) использовали для выделения РНК из полученных клеток. Синтез кДНК осуществляли с использованием олиго-праймеров и набора для синтеза ревертаидной первой цепи кДНК (Fermentas, Англия). ПЦР в реальном времени проводили в Rotor-Gene 6000 Real-time Thermal Cycler (Corbett Research Pty. Ltd., Австралия). Смесь для ПЦР содержала 10 мкл экстрагированной РНК и 1 мкл олиго, ингибитора рибонуклеазы, дезоксинуклеозидтрифосфата (dNTP) и фермента реверстанскриптазы.Затем последовательно добавляли следующие компоненты: 2,5 мкл 10-кратного буфера, 0,5 мкл 10 мМ dNTP, 1 мкл праймера F, 1 мкл праймера R, 2 мкл приготовленной ДНК Taq, 0,5 мкл фермента полимеразы и H 2 O для достижения конечного объема 25 мкл. Затем кДНК амплифицировали в следующих условиях:

денатурация при 95 ° C в течение 10 минут, денатурация при 95 ° C в течение 15 секунд, отжиг при 60 ° C в течение одной минуты и удлинение при 72 ° C в течение одной минуты, все Процесс проводили за 40 циклов (23-25).В конце концов, кривая плавления была построена с помощью программного обеспечения кривой плавления. Этот протокол использовался для всех трех генов. Все праймеры, используемые в ПЦР в реальном времени, были разработаны с помощью программного обеспечения Allele ID (версия 7.6) в соответствии с.

Таблица 1

Гены и праймеры, используемые в полимеразной цепной реакции в реальном времени

Название гена Последовательности праймеров Масштаб
Col II-F CTGA02 мкмоль
Col II-F CCTGGATAACCTCTGTGA
Агра-F GTGGGACTGAAGTTCTTG 0,02 мкмоль
Агра-R GTTGTCATGGTCTGAAGTT
GAPDH-F AAGTCATTTCCTGGTATG 0,02 мкмоль
GAPDH-R CTTCCTCTTGTGCTCTTG
Col XF AGAGAATCCATG02 мкмоль
Col XR AGAATCCATCTGAGAATATGC

Статистический анализ

Все статистические анализы выполнялись с использованием программного обеспечения SPSS для Windows (Статистический пакет для социальных наук, Чикаго, версия 19, SPSSinois Inc., версия 19, SPSSinois Inc. , СОЕДИНЕННЫЕ ШТАТЫ АМЕРИКИ). Данные были выражены как среднее значение ± стандартная ошибка среднего. Тест Колмогорова-Смирнова использовался для проверки нормального распределения данных.

Данные были проанализированы с использованием однофакторного дисперсионного анализа и тестов LSD post hoc .Статистически значимыми считались значения P <0,05.

Результаты

Анализ 3- (4,5-диметилтиазолил-2) -2,5-дифенилтетразолийбромида (МТТ)

Результаты нашего анализа МТТ суммированы в. Эти результаты показали, что пиаскледин может значительно увеличивать пролиферацию и выживаемость дифференцированных ADSC клеток в фибриновом каркасе по сравнению с контролями, только TGF-β1 в фибрине и TGF-β1 вместе с пиаскледином в фибриновых группах.

Результаты анализа

МТТ через 14 дней после культивирования ADSC в хондрогенной среде с добавлением TGF-β1, пиаскледина или обоих в фибриновых или фибрин-альгинатных каркасах.Звездочки указывают на значительные различия между группами. * P <0,05, ** P <0,01, *** P <0,001

Кроме того, TGF-β1 вместе с пиаскледином увеличивал пролиферацию ADSC в фибриновом каркасе значительно больше, чем только TGF-β1 в фибрин-альгинатный каркас ( P = 0,045), а также один пиаскледин в фибрин-альгинатном каркасе ( P = 0,045).

ПЦР в реальном времени

Результаты ПЦР в реальном времени показали значительные различия в экспрессии генов коллагена II, X и аггрекана в разных группах ( P <0.01). На 14 день экспрессия гена коллагена типа II была значительно выше в группах TGF-β1 (фибриновые или фибрин-альгинатные каркасы) по сравнению с группами пиаскледина (фибриновые или фибрин-альгинатные каркасы) ( P <0,05). Хотя экспрессия генов коллагена II и аггрекана не показала значительного увеличения на 14-й день, пиаскледин мог индуцировать хондрогенез в одиночку. Наивысшая экспрессия аггрекана была в одном TGF-β1 или вместе с пиаскледином в группах фибрин-альгинатного каркаса.Самая высокая экспрессия гена коллагена типа X была в TGF-β1 в группе фибрин-альгинатного каркаса ( P <0,001). Кроме того, экспрессия гена коллагена типа X ниже у одного пиаскледина в фибрине и только у TGF-β1 или вместе с пиаскледином в группах фибринового каркаса ().

Результаты экспрессии генов коллагена II (a), коллагена Χ (b) и аггрекана в разных группах через 14 дней после культивирования стволовых клеток, полученных из жировой ткани. Данные представлены как среднее ± стандартное отклонение. Планки погрешностей представляют собой стандартное отклонение среднего значения.Звездочки указывают на значительные различия между группами. N.S: Незначительно, * P <0,05, ** P <0,01, *** P <0,001. Относительное количество (RQ) указывает на относительный уровень экспрессии гена.

Обсуждение

TGFβ1 представляет собой белок-член полипептида, который выполняет многие клеточные функции, такие как пролиферация и дифференцировка клеток. Он способен стимулировать хондроциты синтезировать коллаген II типа и протеогликаны. Он также используется для индукции хондрогенной дифференцировки различных мезенхимальных стволовых клеток (26).Из-за некоторых неблагоприятных эффектов TGF-β, таких как образование гипертрофии дифференцированных хондроцитов из ADSC, рассматриваются другие альтернативы.

Пиаскледин (неомыляемые вещества авокадо / сои) — это натуральный растительный экстракт, на одну треть состоящий из неомыляемых веществ авокадо и на две трети сои. На клиническом уровне пиаскледин уменьшает боль и жесткость суставов, что приводит к снижению зависимости от анальгетиков (27). Уже сообщалось, что присутствие пиаскледина в культуральной среде в течение 21 дня может вызывать хондрогенез ADSC в фибриновых или фибрин-альгинатных каркасах (28, 29).В настоящем исследовании потенциал хондрогенной индукции пиаскледина и TGFβ1 одновременно сравнивали на 14 день после культивирования ADSC в фибриновых или фибрин-альгинатных каркасах.

Результаты нашего анализа МТТ показали, что присутствие пиаскледина способно увеличить пролиферацию и выживаемость дифференцирующихся хондроцитов в фибриновых каркасах, и он более эффективен, чем TGFβ1. В соответствии с нашими результатами, некоторые исследователи сообщили, что пиаскледин обладает хондропротекторными, анаболическими и антикатаболическими свойствами.Кроме того, он препятствует разрушению хряща и способствует восстановлению хряща (8, 9, 30, 31). Кроме того, Piascledine изменяет уровни фактора роста, участвующие в патогенезе остеоартрита, увеличивая TGF-β1 и TGF-β2 в жидкости коленного сустава собак (32) и снижает опосредованную воспалением деградацию хряща за счет снижения продукции IL-1, PGE2 и MMP-3 в культивированные суставные хондроциты (33).

Пиаскледин стимулирует синтез коллагена и протеогликанов в культивируемых хондроцитах (34).Исследование in vitro показало, что пиаскледин может стимулировать выработку аггрекана и восстанавливать выработку аггрекана после лечения ИЛ-1 бета (31). В этом исследовании анализ результатов ПЦР в реальном времени на 14 день после культивирования ADSC показал, что экспрессия коллагена типа II выше в группах TGF-β1. Экспрессия гена аггрекана была выше в одном только TGF-β1 или вместе с пиаскледином в фибрин-альгинатных каркасах. Кроме того, экспрессия гена коллагена типа X была ниже в одном пиаскледине или вместе с TGF-β1 в фибриновых каркасах.Следует отметить, что для того, чтобы вызвать хондрогенез в стволовых клетках и достичь гиалинового хряща, следует снизить экспрессию гена коллагена X, чтобы предотвратить гипертрофию сконструированного хряща. За исключением результатов для гена коллагена типа X, полученные результаты, относящиеся к коллагену типа II и аггрекану, противоречат предыдущим сообщениям на 21 день после культивирования дифференцирующих ADSC. Согласно этим предыдущим результатам, пиаскледин может значительно увеличивать экспрессию генов коллагена II типа и аггрекана по сравнению с TGFβ1 во время индукции хондрогенеза в ADSC (28, 29).Кажется, что 14 дней культивирования недостаточно для обнаружения высокого уровня экспрессии коллагена типа II и генов аггрекана в дифференцированных ADSC, и экспрессия этих генов повысится через 21 день после культивирования ADSC.

Использование соответствующих каркасов — одна из основных проблем тканевой инженерии. Эти каркасы должны быть очень похожи на внеклеточный матрикс суставного хряща (5, 35).

Кроме того, механическая стабильность и неактивность каркаса играют важную роль в сохранении клеток и биоматериалов.Эти биоматериалы необходимы для клеточной адгезии, пролиферации и дифференцировки в поврежденных тканях (36-38). В тканевой инженерии биоматериалы специфичны для каждой ткани, и в большинстве случаев используются гидрогели, такие как фибрин, который состоит из внеклеточных белков матрикса (38). Каркас из фибрина имеет равномерное распределение клеток и может легко вмещать биомолекулы (15).

Этот каркас является биологически разлагаемым и может без труда использоваться для восстановления различных поврежденных тканей (39).Dragoo и др. . показали, что фибрин является наиболее подходящей основой для восстановления суставного хряща кролика (40). В исследовании сообщается, что смешивание хондроитинсульфата с фибрином увеличивает экспрессию гена коллагена II и GAG (группоспецифический антиген) по сравнению с одним фибрином (41). Также Girandon и др. . показали, что ADSC способны воспроизводиться и выживать в фибриновом каркасе (42). Примечательно, что в отличие от предыдущих исследований, в которых использовался коммерческий фибрин, человеческий фибрин был приготовлен вручную и использован в этом исследовании.Хотя фибрин обладает уникальными вязкоупругими свойствами, он является слабым с точки зрения устойчивости, а также быстро разрушается.

Смешивание фибрина с альгинатом может повысить устойчивость каркаса (15, 43). Альгинат получают из бурых водорослей или полисахаридной капсулы бактерий. Натуральный полисахаридный альгинат легко образует гель без необходимости использования органических растворителей или изменения pH и температуры. Хотя альгинат является пористым в гелеобразном состоянии, и эта характеристика способствует диффузии в него макромолекул, он является слабым и хрупким с точки зрения эластичности.Комбинация альгината и фибрина увеличивает его эластичность в качестве основы. Фактически, смесь фибрина и альгината обеспечивает баланс между деградацией и эластичностью и может создавать подходящий внеклеточный матрикс для роста клеток. (44-46). Ма и др. . использовали комбинацию фибрина и альгината в качестве каркаса для индукции хондрогенеза в BMSC и показали, что фибрин увеличивает эластичность каркаса, а также увеличивает пролиферацию клеток. Более того, альгинат увеличивает экспрессию генов, специфичных для хряща, и продукцию внеклеточного матрикса (47).Наши результаты показывают, что пиаскледин может значительно поддерживать выживаемость дифференцирующихся ADSC в фибриновых каркасах лучше, чем любые другие группы. Кроме того, использование одного пиаскледина или вместе с TGF-β1 снижает экспрессию коллагена типа X в фибриновых каркасах. Результаты показывают, что фибриновые каркасы обеспечивают лучшие результаты, чем фибрин-альгинатные каркасы.

Заключение

Пиаскледин может улучшать пролиферацию и выживаемость дифференцирующихся ADSC в хондроциты в фибриновых каркасах.Хотя предыдущие отчеты продемонстрировали, что пиаскледин может увеличивать экспрессию коллагена типа II и аггрекана после 21 дня культивирования дифференцирующихся ADSC, 14 дней культивирования недостаточно для обнаружения высокой экспрессии этих генов. Кроме того, использование Piascledine снижает экспрессию гипертрофического маркера коллагена типа X в фибриновых каркасах.

Благодарность

Результаты, представленные в этой статье, были взяты из двух кандидатских диссертаций (393722 и 394263). Авторы выражают благодарность за поддержку Исфаханскому университету медицинских наук, Исфахан, Иран.

Конфликт интересов

В этом исследовании нет конфликта интересов.

Ссылки

2. Митчелл Н., Шепард Н. Восстановление поверхности суставного хряща взрослого кролика путем множественных перфораций через субхондральную кость. J Bone Joint Surg Am. 1976; 58: 230–233. [PubMed] [Google Scholar] 3. Мардани М., Хашемибени Б., Ансар М.М., Исфахани С.Х., Каземи М., Гохарян В. и др. Сравнение хондрогенных маркеров дифференцированных хондроцитов из стволовых клеток, полученных из жировой ткани, и суставных хондроцитов in vitro .Иран Дж. Базовая медицина. 2013; 16: 763–773. [Бесплатная статья PMC] [PubMed] [Google Scholar] 4. Colter DC, Sekiya I, Prockop DJ. Идентификация субпопуляции быстро самообновляющихся и мультипотенциальных взрослых стволовых клеток в колониях стромальных клеток костного мозга человека. Proc Natl Acad Sci USA. 2001; 98: 7841–7845. [Бесплатная статья PMC] [PubMed] [Google Scholar] 5. Хахемибени Б., Разави Ш., Эсфандиари Э., Карбаси С., Мардани М., Насресфахани М. Индукция хондрогенной дифференцировки стволовых клеток, полученных из жировой ткани человека, с TGF-β3 в системе культивирования осадка.Иран Дж. Базовая медицина. 2008; 11: 10–17. [Google Scholar] 6. Джованнини С., Диас-Ромеро Дж., Айгнер Т., Хейни П., Майнил-Варле П., Несич Д. Совместное культивирование микромасс суставных хондроцитов человека и мезенхимальных стволовых клеток костного мозга человека для исследования стабильного образования неокрящевой ткани in vitro . Eur Cell Mater. 2010; 20:59. [PubMed] [Google Scholar] 8. Henrotin YE, Labasse AH, Jaspar JM, De Groote DD, Zheng SX, Guillou GB, et al. Влияние трех неомыляемых смесей авокадо / сои на продукцию металлопротеиназ, цитокинов и простагландина Е 2 суставными хондроцитами человека.Clin Rheum. 1998; 17: 31–39. [PubMed] [Google Scholar] 9. Mauviel A, Daireaux M, Hartmann DJ, Galera P, Loyau G, Pujol JP. Влияние неомыляемых экстрактов авокадо / соевых бобов (PIAS) на выработку коллагена культурами синовиоцитов, суставных хондроцитов и фибробластов кожи. Преподобный Рум Мал Остеоартик. 1989; 56: 207. [На французском] [PubMed] [Google Scholar] 10. Охотник DJ. Фармакологическая терапия остеоартроза — эпоха модификации болезни. Nat Rev Rheumatol2010; 7: 13–22. [PubMed] [Google Scholar] 11.Брин А., Докери П., О’Брайен Т., Пандит А. Фибриновый каркас способствует переносу аденовирусного гена и контролируемой доставке вектора. J Biomed Mater Res A. 2009; 89: 876–884. [PubMed] [Google Scholar] 12. Чен Г., Ушида Т., Татейши Т. Биоразлагаемая гибридная губка, вложенная в коллагеновые микрогубки. J Biomed Mater Res. 2000. 51: 273–279. [PubMed] [Google Scholar] 13. Лахиджи А., Сохраби А., Хангерфорд Д.С., Фрондоза К.Г. Хитозан поддерживает экспрессию белков внеклеточного матрикса в остеобластах и ​​хондроцитах человека.J Biomed Mater Res. 2000. 51: 586–595. [PubMed] [Google Scholar] 14. Чжоу Х., Сюй Х. Быстрое высвобождение стволовых клеток из микрогранул альгината-фибрина в инъекционных каркасах для инженерии костной ткани. Биоматериалы. 2011; 32: 7503–7513. [Бесплатная статья PMC] [PubMed] [Google Scholar] 15. Buser Z, Лю Дж., Торн KJ, Coughlin D, Lotz JC. Воспалительный ответ клеток межпозвоночного диска снижается за счет фибринового герметика in vitro. J Tissue Eng Regen Med. 2014; 8: 77–84. [PubMed] [Google Scholar] 16. Шиканов А., Сюй М., Вудрафф Т.К., Ши Л.Д.Взаимопроникающие фибрин-альгинатные матрицы для развития in vitro яичникового фолликула. Биоматериалы. 2009. 30: 5476–5485. [Бесплатная статья PMC] [PubMed] [Google Scholar] 17. Моррис VJ. Гелеобразование полисахаридов. В: Митчелл Дж. Р., Ледвард Д. А., редакторы. Функциональные свойства макромолекул пищевых продуктов. Нью-Йорк: Эльзевир; 1986. С. 121–128. [Google Scholar] 18. Хашемибени Б., Разави С., Эсфандиари Э., Карбаси С., Мардани М., Садеги Ф. и др. Влияние трансформирующего фактора роста β3 и факторов роста костного морфогенетического белка-6 на хондрогенную дифференцировку стволовых клеток, полученных из жировой ткани, в альгинатном каркасе.J Isfahan Med Sch. 2010: 28. [На персидском языке] [Google Scholar] 19. Ян Ш., У СС, Ши ТТ, Чен П.К., Линь Ф.Х. Трехмерная культура клеток пульпозного ядра человека в фибриновом сгустке: сравнение клеточной пролиферации и синтеза матрикса с клетками в альгинате. Искусственные органы. 2008. 32: 70–73. [PubMed] [Google Scholar] 20. Валиани А., Хашемибени Б., Эсфандиари Э., Ансар М.М., Каземи М., Эсмаили Н. Изучение влияния углеродных нанотрубок на хондрогенез стволовых клеток, полученных из жировой ткани человека, в альгинатном каркасе.Int J Prev Med. 2014; 5: 825–834. [Бесплатная статья PMC] [PubMed] [Google Scholar] 21. Роули Дж. А., Мадламбаян Дж., Муни Диджей. Альгинатные гидрогели как материалы синтетического внеклеточного матрикса. Биоматериалы. 1999; 20: 45–53. [PubMed] [Google Scholar] 22. Wang ZY, Zhang QZ, Konno M, Saito S. Золь-гель переход альгинатного раствора путем добавления различных двухвалентных катионов: спектроскопическое исследование 13C-ЯМР. Биополимеры. 1993; 33: 703–711. [Google Scholar] 23. Эсфандиари Э., Валиани А., Хашемибени Б., Моради I, Наримани М.Оценка токсичности углеродных нанотрубок на стволовые клетки, полученные из жировой ткани человека in vitro . Adv Biomed Res. 2014; 3:40. [Бесплатная статья PMC] [PubMed] [Google Scholar] 24. Ян Дж., Донг Л., Чжан Б., Ци Н. Влияние чрезвычайно низкочастотного магнитного поля на рост и дифференцировку мезенхимальных стволовых клеток человека. Electromagn Bio Med. 2010. 29: 165–176. [PubMed] [Google Scholar] 25. Криси С.М., О’Нил К.Ф., Аруланандам Б.П., Сильвия В.Л., Навара С.С., Бизиос Р. Остеодифференцировка мезенхимальных стволовых клеток в ответ на переменный электрический ток.Tiss Eng Часть A. 2012; 19: 467–474. [Бесплатная статья PMC] [PubMed] [Google Scholar] 26. Гримо Э., Хейманн Д., Редини Ф. Последние достижения в области влияния TGF-β на метаболизм хондроцитов: потенциальные терапевтические роли TGF-β в заболеваниях хряща. Обзоры цитокинов и факторов роста. 2002; 13: 241–257. [PubMed] [Google Scholar] 27. Кристиансен Б.А., Бхатти С., Гударзи Р., Эмами С. Управление остеоартритом с неомыляемыми веществами из авокадо / сои. Хрящ. 2015; 6: 30–44. [Бесплатная статья PMC] [PubMed] [Google Scholar] 28.Дидехвар Х., Голшан-Иранпур Ф., Валиани А., Хашемибени Б., Эсмаэли М. Сравнение эффектов трансформирующего фактора роста бета1 (TGF-ß1) и пиаскледина на экспрессию генов коллагена II, X и аггрекана в хондрогенезе человеческого жира, полученного из жировой ткани. стволовые клетки в композитном каркасе фибрина-альгината. J Isfahan Med Sch. 2016; 34: 157–165. [На персидском языке] [Google Scholar] 29. Эсмаили М., Хашемибени Б., Валиани А., Амирпур Н., Пурмоллааббаси Б., Каземи М. Влияние пиасклидина на индукцию хондрогенеза стволовыми клетками, полученными из жировой ткани человека, в фибриновом каркасе.J Isfahan Med Sch. 2016; 33: 1862–1870. [На персидском языке] [Google Scholar] 30. Lamaud E, Robert AM, Wepierre J. Биохимические эффекты неомыляемых липидных компонентов авокадо и сои, вводимых чрескожно на соединительнотканные компоненты безволосой кожи крысы. Int J Cosmet Sci. 1979; 1: 213–219. [PubMed] [Google Scholar] 31. Хенротин Ю.Е., Санчес С., Деберг М.А., Пиккарди Н., Гийо Г.Б., Мсика П. и др. Неомыляемые вещества авокадо / соевые бобы увеличивают синтез аггрекана и снижают выработку катаболических и провоспалительных медиаторов хондроцитами человека при остеоартрите.J Rheumatol. 2003; 30: 1825–1834. [PubMed] [Google Scholar] 32. Altinel L, Saritas ZK, Kose KC, Pamuk K, Aksoy Y, Serteser M. Лечение неомыляемыми экстрактами авокадо и сои увеличивает уровни TGF-beta1 и TGF-beta2 в суставной жидкости собак. Tohoku J Exp Med. 2007. 211: 181–186. [PubMed] [Google Scholar] 33. Липпиелло Л., Нардо Дж. В., Харлан Р., Чиу Т. Метаболические эффекты неомыляемых веществ авокадо / сои на суставные хондроциты. Evid Based Complement Alternat Med. 2008; 5: 191–197. [Бесплатная статья PMC] [PubMed] [Google Scholar] 34.Kucharz EJ. Применение неомыляемых смесей авокадо / сои (пиаскледин) в лечении пациентов с остеоартритом. Ortop Traumatol Rehabil. 2003. 5: 248–251. [PubMed] [Google Scholar] 35. Hunziker EB. Вызванное фактором роста заживление дефектов частичной толщины суставного хряща взрослого человека. Хрящевой артроз. 2001; 9: 22–32. [PubMed] [Google Scholar] 36. Джордж М, Авраам TE. Полиионные гидроколлоиды для доставки в кишечник белковых препаратов: альгината и хитозана — обзор. J Control Release.2006; 114: 1–14. [PubMed] [Google Scholar] 37. Раби А., Эсфандиари Э., Фешараки М., Санайе М., Аминмансур Б., Хашемибени Б. Доступ к трехмерной культуре остеобластов, происходящей из свода черепа человека в Иране. J Isfahan Med Sch. 2010; 27: 777–787. [На персидском языке] [Google Scholar] 38. Харрисон П., Уилборн Б., Дебили Н., Вайнченкер В., Бретон-Гориус Дж., Лори А.С. и др. Поглощение фибриногена плазмы альфа-гранулами мегакариоцитов и тромбоцитов человека. J Clin Invest. 1989; 84: 1320–1324. [Бесплатная статья PMC] [PubMed] [Google Scholar] 39.Ле Нихуаннен Д., Гуэннек Л.Л., Руийон Т., Пилет П., Бильбан М., Лейролле П. и др. Микроархитектура гранул фосфата кальция и композитов фибринового клея для инженерии костной ткани. Биоматериалы. 2006. 27: 2716–2722. [PubMed] [Google Scholar] 40. Драгу Дж. Л., Карлсон Дж., Маккормик Ф., Хан-Фаруки Х., Чжу М., Зук П. А. и др. Заживление дефектов хряща на всю толщину с помощью стволовых клеток, полученных из жировой ткани. Tissue Eng. 2007; 13: 1615–1621. [PubMed] [Google Scholar] 41. Вэй Й, Ху Й, Хао В, Хан И, Мэн Г, Чжан Д. и др.Новый инъекционный каркас для инженерии хрящевой ткани с использованием взрослых стволовых клеток, полученных из жировой ткани. J Orthop Res. 2008. 26: 27–33. [PubMed] [Google Scholar] 42. Girandon L, Kregar-Velikonja N, Bozikov K, Barlic A. In vitro модели для инженерии жировой ткани со стволовыми клетками, полученными из жировой ткани, с использованием различных каркасов природного происхождения. Folia Biol. 2011; 57: 47–56. [PubMed] [Google Scholar] 43. Чжао Л., Weir MD, Xu HH. Инъекционная паста из мезенхимальных стволовых клеток из фосфатно-альгинатного кальция и пуповины для инженерии костной ткани.Биоматериалы. 2010. 31: 6502–6510. [Бесплатная статья PMC] [PubMed] [Google Scholar] 44. Chien CS, Ho HO, Liang YC, Ko PH, Sheu MT, Chen CH. Включение экссудатов богатого тромбоцитами геля фибрина человека в биоразлагаемые фибриновые каркасы для тканевой инженерии хряща. J Biomed Mater Res B Appl Biomater. 2012; 100: 948–955. [PubMed] [Google Scholar] 45. Стивенс М.М., Канадило Х.Ф., Лангер Р., Прасад С.В. Альгинатная гелевая система быстрого отверждения: применение в инженерии хрящевой ткани надкостницы. Биоматериалы.2004. 25: 887–894. [PubMed] [Google Scholar] 46. Стивенс М.М., Марини Р.П., Мартин I, Лангер Р., Прасад С.В. FGF-2 усиливает индуцированный TGF-beta1 периостальный хондрогенез. J Orthop Res. 2004; 22: 1114–1119. [PubMed] [Google Scholar] 47. Ма HL, Hung SC, Lin SY, Chen YL, Lo WH. Хондрогенез мезенхимальных стволовых клеток человека, инкапсулированных в альгинатные шарики. J Biomed Mater Res. 2003. 64: 273–281. [PubMed] [Google Scholar]

Как улучшить здоровье суставов

Среди неопасных для жизни проблем со здоровьем, здоровье суставов (или его отсутствие), вероятно, больше всего влияет на качество нашей жизни.Как и многие другие вещи, пока вы не потеряете их способность, вы не цените того, как много они для вас делают. Исследование, опубликованное в августе этого года, показало, что из 27 миллионов американцев, страдающих артритом, 1 40 процентов мужчин и 56 процентов женщин с остеоартритом коленного сустава (ОА) полностью неактивны. 2 Эти номера были названы лидерами в этой области «отрезвляющим» и «тревожным сигналом» как для больных, так и для их врачей — это также просто позор.

Так что действительно удачно, что существует так много вариантов добавок, которые помогают поддерживать здоровье суставов.Они делают это двумя основными способами: поддержание хряща (наращивание, с одной стороны, и предотвращение разрушения, с другой) и облегчение воспаления и боли. Оба эти фактора являются механизмами при ОА, типе артрита, наиболее изученном в отношении пищевых добавок. Таким образом, объединение ингредиентов из обеих этих категорий обеспечивает комплексную терапию. Кроме того, некоторые ингредиенты относятся к обеим категориям.

Прежде чем перейти к самим добавкам, давайте посмотрим на природу суставов и на то, как развивается остеоартрит.Различные компоненты суставов служат буферами между костями, обеспечивая амортизацию и гибкость. Он состоит из хряща, покрывающего концы костей, синовиальной оболочки, покрывающей хрящ, и синовиальной жидкости, которая заполняет пространство между двумя костями и омывает синовиальную оболочку и хрящ. В здоровом суставе происходит обновление хряща, которому, помимо прочего, способствуют разрушающие ферменты, называемые матриксными металлопротеиназами (ММП). Этому противодействует синтез нового хряща и ингибиторов ММП, которые обеспечивают динамический баланс.При остеоартрите этот баланс нарушается, что благоприятствует процессам разрушения, что приводит к разрушению хряща, трению между костями, боли и воспалению. 3

Уход за хрящом

Это область нескольких старых резервных систем в категории совместное здоровье. Хотя потребители взвешивают свои кошельки, большая часть данных исследований неоднозначна. Сила данных, по крайней мере, в такой же степени связана с пониманием, методологической строгостью и стандартизацией материалов, которые используются в дизайне исследования, как и с эффективностью самого дополнения.

Глюкозамин и хондроитин

Глюкозамин, который синтезируется из глюкозы в организме, является лимитирующим этапом в синтезе гликозаминогликанов, составляющих хрящ, а также хондроитинсульфата и гиалуроновой кислоты. 4 Считается, что глюкозамин также подавляет медиаторы разрушения хряща, такие как ММП. 3,5

Исследования на людях с использованием глюкозамина показали улучшение тяжести заболевания и боли на 28 процентов и 21 процент соответственно, 6,7,8 по сравнению с плацебо, как показано в обзоре Кокрановской базы данных 20 рандомизированных контролируемых испытаний за 2005 год. 9 Одно ретроспективное исследование с участием 340 пациентов с ОА показало, что глюкозамин устраняет необходимость в замене суставов после приема добавок от 12 месяцев до трех лет, даже через пять лет после прекращения приема добавок. 10 Однако более поздние метаанализы не смогли рекомендовать глюкозамин на основании объединенных данных. 11 Помимо обычных ссылок на неоднородность, низкое качество исследования и недостаточную продолжительность исследования, было высказано предположение, что фактическими проблемами являются недостаточная дозировка и несоответствие химической активности и биодоступности материала, и что если они будут учтены, данные был бы решительно в пользу эффекта. 12 Сиамский двойной хондроитин глюкозамина также является одним из строительных блоков гликозаминогликанов для хряща и важным компонентом синовиальной жидкости.

Недавний метаанализ был сосредоточен на его способности предотвращать сужение суставов и показал небольшой положительный результат в трех объединенных испытаниях, которые длились два года. 13

Недавно опубликованное многоцентровое рандомизированное двойное слепое контролируемое пилотное исследование с участием 69 пациентов с ОА коленного сустава показало, что потеря хряща уменьшилась уже через шесть месяцев после 12-месячного режима приема 800 мг / день. 14 Однако другие метаанализы не смогли показать влияние на функцию или уменьшение боли, с теми же проблемами неоднородности исследования, о которых говорилось для глюкозамина. 15,16

Коллаген

Коллаген типа II является основным компонентом хряща и главной мишенью ферментов, которые его расщепляют. Компания InterHealth Nutraceuticals, производитель UC-II, неденатурированного коллагена типа II, впервые начала тестирование на людях с ОА; предыдущие исследования были ограничены животными или пациентами с ревматоидным артритом.90-дневное исследование 2009 г. с участием 52 пациентов с ОА показало, что по сравнению с лечением глюкозамином и хондроитином (1500 мг и 1200 мг / день соответственно), UC-II (40 мг / день) показал статистически значимо лучший ответ на уменьшение боли и физическая функция. 17 Вместо конкурентного подхода потребителю было бы лучше понять аддитивные эффекты UC-II и глюкозамина / хондроитина.

MSM

Метилсульфонилметан является еще одним важным продуктом для здоровья суставов и используется благодаря высокому содержанию серы, которая важна для образования поперечных связей, укрепляющих хрящ.Краткосрочные (трехмесячные) исследования показали, что МСМ снижает боль у пациентов с ОА. В рандомизированном двойном слепом плацебо-контролируемом исследовании с участием 50 пациентов с ОА 3 г МСМ два раза в день значительно уменьшили функциональные нарушения и боль по сравнению с плацебо. 18 Комбинированный эффект МСМ и глюкозамина (оба при приеме 1500 мг / день) был изучен в исследовании с участием 118 пациентов с ОА и обнаружил, что они более эффективны в улучшении функциональности и отека вместе, чем по отдельности. 19 В то же время метаанализ пришел к выводу, что существуют «положительные, но не окончательные» доказательства эффективности МСМ. 20 До сих пор эффективность ДМСО (диметилсульфоксид, окисленная форма МСМ) не была хорошо изучена в результате исследований низкого качества.

Гиалуроновая кислота

Это компонент синовиальной жидкости, который заполняет полость сустава и придает жидкости вязкоупругие и смазывающие свойства. При ОА количество гиалуроновой кислоты снижается, что ставит под угрозу эти свойства.Инъекции гиалуроновой кислоты в колено иногда используются в качестве терапии, но пероральный прием менее изучен. Компания Bioiberica, производитель Hyal-Joint (60% гиалуроновой кислоты), добилась успеха, выполнив пилотное рандомизированное двойное слепое контролируемое испытание с использованием 80 мг / день у 20 пациентов с ОА коленного сустава, обнаружив значительное улучшение физического и социального состояния. функционирование, а также боль по сравнению с плацебо. 21

Облегчение боли и воспаления

Новое исследование показывает, что воспаление — это не просто симптом дегенерации суставов, а проявляется с самого начала.Фактически, уровень воспалительных соединений выше на ранней стадии артрита, чем на поздней стадии. Кроме того, медиаторы воспаления активируют ферменты, разрушающие хрящ, образуя петлю положительной обратной связи. Это является еще более убедительным аргументом в пользу объединения этих ингредиентов с ингредиентами, способствующими образованию хряща. Ниже описаны несколько хорошо известных противовоспалительных ингредиентов для здоровья суставов, а также некоторые перспективные разработки, которые представляют собой вполне обоснованные возможности для развития. Почти все действуют, ингибируя либо ЦОГ-2 (циклооксигеназа-2), либо 5-LOX (5-липоксигеназа) — две ключевые молекулы, запускающие воспалительный каскад.

Ладан — старое лекарство, которое продолжает использовать новые приемы по мере развития знаний. Это растительный продукт, сок растения Boswellia serata, также известного как ладан. Двумя основными активными ингредиентами являются босвеллиевые кислоты, 11-кето-ß-босвеллиевая кислота (KBA) и ацетил-11-кето-ß-босвеллиевая кислота (AKBA).

Laila Nutraceuticals в партнерстве с P.L. Томас внес свой вклад в науку, протестировав свой стандартизированный AKBA ингредиент 5-локсина в рандомизированном двойном слепом плацебо-контролируемом исследовании, показав снижение боли и скованности, а также повышение физической функции у пациентов с ОА на уровне 100–250 мг / день. всего за семь дней (на уровне 250 мг).Они также показали, что он действует как противовоспалительное средство, ингибируя фермент 5-LOX. Наконец, они задокументировали снижение количества ММП в синовиальной жидкости, предполагая, что босвеллия также может замедлять деградацию хряща. 22

Laila Nutraceuticals также недавно разработала новую смесь из растения босвеллии под названием Афлапин, которая в сравнительном исследовании 2010 года показала большую биодоступность и большую эффективность в качестве противовоспалительного и ингибитора ферментов, разрушающих хрящ, чем 5-локсин, когда каждый из них сравнивался с плацебо ( однако статистические данные не были сделаны, чтобы показать, были ли относительные улучшения статистически значимо отличными друг от друга). 23

Оба продукта под маркой обладают хорошими характеристиками безопасности, переносимости и токсикологии.

Исследование 2011 года поставило под сомнение, являются ли KBA и AKBA активными ингредиентами, утверждая, что их низкая биодоступность приводит к слишком низким уровням в сыворотке, чтобы ингибировать 5-LOX. Авторы вместо этого отмечают, что ß-босвеллиевая кислота обнаруживается в сыворотке в концентрациях в 100 раз выше и что она ингибирует воспалительные соединения простагландин Е-синтазу-1 и сериновую протеазу катепсин G, что, возможно, следует рассматривать как механизм действия. 24 Если бы это было так, это бы изменило способ обработки и стандартизации продуктов.

Глюкозамин и хондроитин

Есть причина, по которой эти двое почти всегда являются основой формулы здоровья суставов. Помимо того, что они являются строителями хряща и синовиальной жидкости, они также подавляют многие медиаторы воспаления и снижают синтез ЦОГ-2. 3

Куркума / куркумин

Куркумин (диферулоилметан) является основным компонентом куркумы и отвечает за ее цвет и вкус.В то время как многочисленные исследования in vitro и in vivo за последние 20 лет показали его эффекты в качестве ингибитора ЦОГ-2, 5-LOX и многих из их последующих продуктов, 25 короткий период полувыведения из сыворотки, конъюгация и низкий биодоступность помешала сильным результатам у людей. 25,26 Улучшение биодоступности может быть ключом к продвижению исследований и повышению эффективности этого ингредиента.

Омега-3

Отчасти магия омега-3 связана с его противовоспалительными свойствами, поэтому вполне естественно, что в какой-то момент омега-3 будут изучены для здоровья суставов.Недавно комбинация омега-3 (DHA и EPA) вместе с глюкозамином сравнивалась с одним глюкозамином в рандомизированном двойном слепом исследовании с участием 177 пациентов с ОА. При добавлении омега-3 к глюкозамину наблюдалось терапевтически значимое дополнительное улучшение утренней скованности и боли. 27 Исследования in vitro и на животных показывают, что омега-3 не только снижают COX-2, но также являются одним из ингредиентов двойного действия, помогая наращивать хрящ и подавлять ферменты, разрушающие хрящ, что делает их отличным средством. кандидат на постановки, а также на дополнительные исследования. 28,29

Ресвератрол

Давняя история о пользе ресвератрола для здоровья сердца затмевает некоторые другие его эффекты. Исследования in vitro в 90-х годах показали, что ресвератрол обладает мощным ингибированием как ЦОГ-2, так и многих его последующих воспалительных модуляторов. 30,31 На молекулярном уровне также было показано, что ресвератрол отключает синтез СОХ-2. 30 Самые последние исследования в этой области были сосредоточены на применении этого свойства при таких состояниях, как рак и диабет, но не на заболеваниях суставов.Учитывая, что при ОА действуют те же воспалительные пути, что и при этих других заболеваниях, ресвератрол заслуживает большего внимания для применения ОА в научных кругах.

Авокадо Соевые Неомыляемые

ASU производится из натурального масла авокадо и соевых бобов и, как было показано, является ингибитором COX-2 и других воспалительных соединений. 32 Потребление только авокадо и сои не может обеспечить количество, необходимое для эффективности. Четыре рандомизированных плацебо-контролируемых исследования были проведены для оценки эффективности ASU как противовоспалительного средства у пациентов с ОА.Метаанализ этих испытаний, в которых участвовали 664 субъекта, принимавшие 300 мг ASU в среднем в течение шести месяцев, показал, что он значительно уменьшил боль и улучшил физическую функциональность по сравнению с плацебо. 33

В Европе ASU доступен как рецептурный препарат Piascledine 300, эффективность которого была проверена на 364 пациентах с ОА. Он сравнил 300 мг пиаскледина с 1200 мг хондроитинсульфата и показал, что оба препарата улучшили боль, скованность и улучшили физическую функцию в одинаковой значительной степени в соответствии со стандартным индексом, и что оба препарата хорошо переносились. 34

Риса Шульман, доктор философии, президент консалтинговой фирмы Tap ~ Root из Нью-Йорка, имеет 13-летний опыт работы в области науки и регулирования в области разработки функциональных продуктов питания и пищевых добавок.
www.linkedin.com/in/risaschulmanphd

Отражение ваших научных данных в досье с обоснованием претензий

  • Соответствующие документы уже рассмотрены и собраны для представления в FDA, если это необходимо — без безумной схватки
  • Может служить справочником при разработке PR и маркетинговой стратегии, продаж и других образовательных презентаций
  • При использовании в качестве справочного документа обеспечивает единообразие коммуникаций
  • Может помочь выявить пробелы в исследованиях
    Структура досье должна содержать:
  • Уровень потребления, к которому относятся утверждения: он должен соответствовать уровням, подтвержденным клиническими испытаниями.
  • Дата и номер версии
  • Список утверждений с использованием точной формулировки, которая будет использоваться при маркировке: часто это результат совместных усилий научно-исследовательских и опытно-конструкторских организаций, отдела маркетинга, продаж и юриспруденции, направленных на выработку соответствующей нормативным требованиям, научно точной и убедительной формулировки.
  • Полные цитаты из документов, использованных для обоснования утверждений: в идеале они должны сопровождаться кратким изложением конкретных доказательств, приведенных в каждой статье.Этот дополнительный шаг — дополнительная ценность, которая может сделать досье справочным материалом для внутреннего персонала.
  • Исследования на людях с подробностями исследования, представленными в кратких резюме. Их можно упорядочить в соответствии с уровнем убедительности, указанным FDA: рандомизированные контролируемые испытания, эпидемиологические исследования, тематические исследования, метаанализы, обзорные статьи, за которыми следуют исследования на животных и значимые исследования in vitro.
  • Краткое изложение доказательств по претензии
  • Обновления по мере их появления: досье следует периодически обновлять и переиздавать по мере добавления новых исследований к совокупности доказательств.

Выбрать поставщиков: шарниры

Акер БиоМарин
Обеспечивает крилевое масло и шрот через оптимизированную производственно-сбытовую цепочку, от сырья до потребителя.
www.AkerBioMarine.com

AKBiotech
Массовый производитель фармацевтических ингредиентов омега-3, предлагающих до 85 процентов DHA и 95 процентов EPA в форме капсул, порошка и эмульсии.
www.akb.co.kr

Bergstrom Nutrition
Эта семейная компания по производству пищевых ингредиентов занимается поставками метилсульфонилметана (МСМ).
www.bergstromnutrition.com

BioCell Technology, LLC
Эксклюзивный поставщик BioCell Collagen II — запатентованного диетического ингредиента, содержащего высокобиодоступный гидролизованный коллаген, гиалуроновую кислоту с низким молекулярным весом (MW) и хондроитинсульфат.
www.biocelltechnology.com

Bioiberica, S.A.
Специализируется на исследованиях, производстве и маркетинге биомолекул для фармацевтической и пищевой промышленности, особенно хондроитинсульфата, гиалуроновой кислоты и глюкозамина.
www.bioiberica.com

Bio Serae Laboratories SAS
Специализируется на производстве и поставке оригинальных активных ингредиентов для нутрицевтики и промышленности. Создатель остеола, натурального ингредиента, который оптимизирует активность стандартных D-глюкозамина и хондроитина в формулах для суставов.
www.bioserae.com

Croda Inc.
Поставщик нутрицевтических и фармацевтических ингредиентов, наполнителей, солюбилизаторов, растительных и морских липидных концентратов, белков и биополимеров.
www.croda.com/healthcare

Cyanotech Corp.
Производитель фирменных функциональных ингредиентов из микроводорослей BioAstin Natural Astaxanthin и Hawaiin Spirulina Pacifica.
www.cyanotech.com

Gelita
Содержит желатин, пептиды коллагена и коллаген, используемые в производстве функциональных пищевых продуктов и пищевых продуктов, которые улучшают здоровье костей и суставов, регулируют калорийность и обогащают белком.
www.gelita.com

Helios Corp.
Разрабатывать и продавать новые ингредиенты для сообщества функциональных продуктов питания и питания, используя клинические исследования фазы I и фазы II на людях.
www.helioscorp.net

Humanetics Corp.
Научная компания, предлагающая решения на основе пищевых добавок для контроля веса и уровня глюкозы, здоровья суставов и спортивных результатов.
www.humaneticsingredients.com

Indena USA Inc.
Сосредоточение усилий на промышленном производстве стандартизированных экстрактов растений для использования в продуктах здорового питания.
www.indena.com

Национальная ферментная компания
Специализируется на рецептурах продуктов и запатентованных фирменных ингредиентах, в частности на уникальных ферментных смесях для всего, от пищеварительных добавок до энергетических добавок.
www.nationalenzyme.com

Nutra Bridge Corp.
Основное внимание уделяется запатентованным фирменным ингредиентам, таким как 7-Keto для похудения, раствор для здоровья суставов MicroLactin и InSea2, первый блокатор крахмала и сахара двойного действия для контроля уровня сахара в крови.
www.smbimilk.com

Nutraceutix Inc.
Поставляет пробиотики в виде порошка, капсул и таблеток с использованием процессов и технологий доставки, которые продлевают срок хранения и защищают пробиотические организмы от желудочной кислоты на пути к кишечнику.
www.nutraceutix.com

P.L. Томас
Предоставляет широкий спектр ингредиентов для здоровья суставов, направленных на улучшение целостности, комфорта и подвижности суставов, включая 5-Loxin и Après Flex.
www.plthomas.com

Собственная компания Nutritionals Inc.
PNI, подразделение Pharmachem Labs, является глобальным продавцом и дистрибьютором нутрицевтических ингредиентов, таких как целадрин для здоровья суставов и перлюксан для обезболивания.
www.pharmachemlabs.com/corporate/pni

TSI Health Sciences Inc.
Поставщики хондроитина и глюкозамина, которые соответствуют или превосходят самые высокие стандарты качества и нормативные требования в мире.
www.tsiinc.com

Sabinsa Corp.
Производит ArthriBlend SR, формулу с замедленным высвобождением растительных экстрактов и питательных веществ для поддержания здоровья суставов и соединительных тканей.
www.sabinsa.com

Soft Gel Technologies Inc.
Обеспечивает контрактное производство мягких гелевых колпачков для индустрии пищевых добавок.
www.soft-gel.com

Stratum Nutrition
Содержит безопасные и надежные ингредиенты, поддерживающие сердечно-сосудистую, структурную, пищеварительную и иммунную системы.
www.stratumnutrition.com

Unigen
Исследования и разработки в области натуральных продуктов для функционального питания, пищевых добавок, космецевтики.
www.unigen.net

Vitaco Health (NZ) Ltd.
Один из крупнейших производителей здорового питания, пищевых добавок и пищевых продуктов в Австралии.
www.vitaco.co.nz

Список литературы

1. http: // www.arthritis.org/osteoarthritis.php, по состоянию на 22 августа 2011 г.
2. Данлоп Д.Д., Сонг Дж., Семаник П.А. и др. Объективное измерение физической активности в рамках инициативы по лечению остеоартрита: соблюдаются ли руководящие принципы? Ревматоидный артрит. 2011 26 июля. Doi: 10.1002 / art.30562.
3. Джерош Дж. Влияние глюкозамина и хондроитинсульфата на метаболизм хряща при ОА: обзор других питательных веществ, особенно жирных кислот омега-3. Int J Rheum Dis. 2011; 2011: 969012.
4. Vista ES и Lau CS.А как насчет добавок от остеоартрита? Критический и основанный на фактах обзор. Int J Rheum Dis. 2011. 14: 152–158.
5. Липпиелло Л. Глюкозамин и хондроитинсульфат: модификаторы биологической реакции хондроцитов в смоделированных условиях суставного стресса. Хрящевой артроз. 2003. 11 (5): 335–42.
6. Регинстер Дж. Я., Деруази Р., Ровати Л. С. и др. Долгосрочные эффекты сульфата глюкозамина на прогрессирование остеоартрита: рандомизированное плацебо-контролируемое клиническое исследование. Ланцет.2001 27 января; 357 (9252): 251-6.
7. Pavelká K, Gatterová J, Olejarová M, Machacek S, Giacovelli G, Rovati LC. Использование сульфата глюкозамина и замедление прогрессирования остеоартрита коленного сустава: трехлетнее рандомизированное плацебо-контролируемое двойное слепое исследование. Arch Intern Med. 2002, 14 октября; 162 (18): 2113-23.
8. Herrero-Beaumont G, Ivorra JA et al. Сульфат глюкозамина в лечении симптомов остеоартрита коленного сустава: рандомизированное двойное слепое плацебо-контролируемое исследование с использованием ацетаминофена в качестве побочного средства сравнения.Ревматоидный артрит. 2007 Февраль; 56 (2): 555-67.
9. Towheed TE, Maxwell L, Anastassiades TP et al. Глюкозаминовая терапия для лечения остеоартроза. Кокрановская база данных Syst Rev.2005, 18 апреля; (2): CD002946.
10. Bruyere O, Pavelka K, Rovati LC et al. Полная замена сустава после лечения глюкозамина сульфатом при остеоартрите коленного сустава: результаты среднего 8-летнего наблюдения за пациентами из двух предыдущих 3-летних рандомизированных плацебо-контролируемых исследований. Хрящевой артроз. 2008 Февраль; 16 (2): 254-60.
11. Bruyère O. Большой обзор не обнаруживает клинически значимого эффекта глюкозамина или хондроитина на боль у людей с остеоартритом колена или бедра, но результаты сомнительны и, вероятно, из-за неоднородности. Evid Based Med. 2011 Апрель; 16 (2): 52-3.
12. Агазаде-Хабаши А., Джамали Ф. Споры о глюкозамине; фармакокинетическая проблема. J Pharm Pharm Sci. 2011; 14 (2): 264-73.
13. Hochberg MC. Изменяющие структуру эффекты хондроитинсульфата при остеоартрите коленного сустава: обновленный метаанализ рандомизированных плацебо-контролируемых исследований продолжительностью 2 года.Хрящевой артроз. 2010 июн; 18 Приложение 1: S28-31.
14. Вильди Л. М., Рейно Дж. П., Мартель-Пеллетье Дж. И др. Хондроитинсульфат уменьшает как потерю объема хряща, так и поражения костного мозга у пациентов с остеоартритом коленного сустава, начиная уже через 6 месяцев после начала терапии: рандомизированное двойное слепое плацебо-контролируемое пилотное исследование с использованием МРТ. Ann Rheum Dis. 2011 июн; 70 (6): 982-9.
15. Блэк С., Клар С., Хендерсон Р. и др. Клиническая эффективность добавок глюкозамина и хондроитина в замедлении или остановке прогрессирования остеоартрита коленного сустава: систематический обзор и экономическая оценка.Оценка медицинских технологий. 2009 ноя; 13 (52): 1-148.
16. Crowley DC, Lau FC, Sharma P et al. Безопасность и эффективность неденатурированного коллагена типа II при лечении остеоартроза колена: клиническое испытание. Int J Med Sci. 2009 Октябрь 9; 6 (6): 312-21.
17. Райхенбах С., Стерчи Р., Шерер М. и др. Мета-анализ: хондроитин при остеоартрозе колена или бедра. Ann Intern Med. 2007. 146 (8): 580–90.
18. Kim LS, et al. Эффективность метилсульфонилметана (МСМ) при остеоартрозе боли в колене: пилотное клиническое испытание.Хрящевой остеоартрит 2006; 14: 286-94.
19. Уша П.Р., Найду М.Ю. Рандомизированное двойное слепое параллельное плацебо-контролируемое исследование перорального приема глюкозамина, метилсульфонилметана и их комбинации при остеоартрите. Clin Drug Investigation. 2004; 24 (6): 353-63.
20. Брайен С., Прескотт П., Башир Н., Льюит Х., Льюит Г. Систематический обзор пищевых добавок диметилсульфоксида (ДМСО) и метилсульфонилметана (МСМ) в лечении остеоартрита. Хрящевой артроз. 2008 ноя; 16 (11): 1277-88.
21. Кальман Д.С., Хеймер М., Вальдеон А., Шварц Х., Шелдон Э. Влияние натурального экстракта куриных гребешков с высоким содержанием гиалуроновой кислоты (Hyal-Joint) на облегчение боли и качество жизни пациентов с остеоартрозом коленного сустава: пилотное рандомизированное двойное слепое плацебо-контролируемое исследование. Нутр Дж. 2008 21 января; 7: 3.
22. Сенгупта К., Аллури К.В., Сатиш А.Р. и др. Двойное слепое рандомизированное плацебо-контролируемое исследование эффективности и безопасности 5-локсина для лечения остеоартрита коленного сустава.Arthritis Res Ther. 2008; 10 (4): R85.
23. Сенгупта К., Кришнараджу А.В., Вишал А.А. и др. Сравнительная эффективность и переносимость 5-локсина и афлапина против остеоартрита коленного сустава: двойное слепое рандомизированное плацебо-контролируемое клиническое исследование. Int J Med Sci. 2010 1 ноября; 7 (6): 366-77.
24. Abdel-Tawab M, Werz O, Schubert-Zsilavecz M. Boswellia serrata: общая оценка in vitro, доклинических фармакокинетических и клинических данных. Клин Фармакокинет. 2011, 1 июня; 50 (6): 349-69.
25. Юренка Ю.С. Противовоспалительные свойства куркумина, основного компонента Curcuma longa: обзор доклинических и клинических исследований. Альтернативная медицина, июнь 2009; 14 (2): 141-53.
26. Ананд П., Куннумаккара А.Б., Ньюман Р.А., Аггарвал Б.Б. Биодоступность куркумина: проблемы и перспективы. Mol Pharm. 2007 ноябрь-декабрь; 4 (6): 807-18.
27. Gruenwald J, Petzold E, Busch R, Petzold HP, Graubaum HJ. Эффект глюкозамина сульфата с омега-3 жирными кислотами или без них у пациентов с остеоартритом.Adv Ther. 2009 сентябрь; 26 (9): 858-71.
28. Hankenson KD, Watkins BA, Schoenlein IA, Allen KG, Turek JJ. Омега-3 жирные кислоты усиливают образование коллагена фибробластов связок в связи с изменениями выработки интерлейкина-6. Труды Общества экспериментальной биологии и медицины. 2000. 223 (1): 88–95.
29. Lippiello L, Fienhold M, Grandjean C. Метаболические и ультраструктурные изменения суставного хряща крыс, получавших пищевые добавки с омега-3 жирными кислотами. Артрит и ревматизм.1990. 33 (7): 1029–1036.
30. Subbaramaiah K, Chung WJ, Michaluart P et al. Ресвератрол ингибирует транскрипцию и активность циклооксигеназы-2 в эпителиальных клетках молочной железы человека, обработанных сложным эфиром форбола. J Biol Chem. 1998 21 августа; 273 (34): 21875-82.
31. Кимура Ю., Окуда Х., Кубо М. Влияние стильбенов, выделенных из лекарственных растений, на метаболизм арахидоната и дегрануляцию в полиморфно-ядерных лейкоцитах человека. J Ethnopharmacol. 1995 Февраль; 45 (2): 131-9.
32. Au RY, Al-Talib TK, Au AY, Phan PV, Frondoza CG.Неомыляемые вещества соевых бобов авокадо (ASU) подавляют экспрессию TNF-альфа, IL-1beta, COX-2, iNOS, а также продукцию простагландина E2 и оксида азота в суставных хондроцитах и ​​моноцитах / макрофагах. Хрящевой артроз. 2007. 15 (11), 1249–55.
33. Кристенсен Р., Бартельс Е.М., Аструп А., Блиддал Х. Симптоматическая эффективность неомыляемых веществ авокадо-сои (ASU) у пациентов с остеоартритом (OA): метаанализ рандомизированных контролируемых исследований. Хрящевой артроз. 2008 апр; 16 (4): 399-408.
34. Pavelka K, Coste P, Géher P, Krejci G. Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом в течение 6 месяцев лечения плюс 2 месяца наблюдения у пациентов с остеоартритом коленного сустава. Clin Rheumatol. 2010 июн; 29 (6): 659-70.

Рандомизированное контролируемое испытание неомыляемого действия авокадо-сои (Piascledine) на модификацию структуры бедра …

Следующий комментарий был написан на этапе бета-тестирования нового проекта F1000Trials, работа над которым сейчас прекращена.Комментарий был опубликован здесь в виде короткой статьи в F1000Prime Reports, чтобы обеспечить его постоянную доступность.

Неомыляемые вещества из авокадо и соевых бобов (ASU), возможно, оказали умеренное благотворное влияние на симптоматический остеоартрит (ОА) тазобедренных и коленных суставов в ходе клинических испытаний {1}. Авторы представляют результаты 3-летнего многоцентрового рандомизированного контролируемого исследования (РКИ) АСС при симптоматическом ОА тазобедренного сустава. Первичным результатом было изменение ширины суставной щели (JSW) на 3-м году жизни на снимках с переднезадней нагрузкой (AP), нацеленных на индекс бедра.Вторичным результатом было соотношение прогрессоров (потеря JSW 0,5 мм или более) по сравнению с не прогрессирующими (потеря JSW <0,5 мм) через 3 года.

Из 399 рандомизированных пациентов было 189 в группе лечения и 210 в группе плацебо; 345, которые приняли по крайней мере одну лечебную дозу и имели по крайней мере 1 исходный и 1 контрольный фильм (полный набор анализов или FAS). Все пациенты, получавшие лечебную дозу, были включены в анализ безопасности. Для FAS не было замечено различий между группами по первичному результату (средний JSN был -0.67 мм для группы плацебо и -0,64 мм для группы лечения). Что касается вторичного результата, у 40% пациентов из группы лечения и у 50% пациентов из группы плацебо прогрессирование наблюдалось (p = 0,04). Аналогичные результаты были получены при использовании разных наборов анализов. Никаких различий между группами не наблюдалось в отношении полной замены тазобедренного сустава или клинических исходов, включая индекс Лекена, индекс артрита университетов Западного Онтарио и Макмастера (WOMAC), общую боль, оценку пациента или использование анальгетиков. Никаких сигналов безопасности замечено не было.

Это исследование, как и большинство предыдущих исследований ASU, спонсировалось производителем.Не было различий между группами при сравнении JSW, и только небольшая разница была замечена при дихотомическом анализе прогрессоров и непрогрессоров, и не было различий в каких-либо клинических исходах. Для независимого подтверждения этих выводов потребуются дальнейшие исследования.

Обзор, применение, побочные эффекты, меры предосторожности, взаимодействия, дозировка и обзоры ASU) при остеоартрозе коленного сустава.Двойное слепое проспективное плацебо-контролируемое исследование. Scand J Rheumatol 2001; 30 (4): 242-247. Просмотреть аннотацию.

Blotman, F., Maheu, E., Wulwik, A., Caspard, H., and Lopez, A. Эффективность и безопасность неомыляемых веществ авокадо / сои при лечении симптоматического остеоартроза коленного и тазобедренного суставов. Проспективное многоцентровое трехмесячное рандомизированное двойное слепое плацебо-контролируемое исследование. Rev Rhum Engl Ed 1997; 64 (12): 825-834. Просмотреть аннотацию.

Бумедьен, К., Фелисаз, Н., Богданович, П., Galera, P., Guillou, G. B. и Pujol, J. P. Неомыляемые вещества авокадо / сои усиливают экспрессию трансформирующих факторов роста бета1 и бета2 в культивируемых суставных хондроцитах. Ревматоидный артрит. 1999; 42 (1): 148-156. Просмотреть аннотацию.

Henrotin, YE, Labasse, AH, Jaspar, JM, De Groote, DD, Zheng, SX, Guillou, GB, и Reginster, JY Влияние трех неомыляемых смесей авокадо / сои на выработку металлопротеиназ, цитокинов и простагландина E2 суставными тканями человека. хондроциты.Clin.Rheumatol. 1998; 17 (1): 31-39. Просмотреть аннотацию.

Хайял М. Т. и Эль Газали М. А. Возможный «хондрозащитный» эффект неомыляемых компонентов авокадо и сои in vivo. Препараты Exp.Clin.Res. 1998; 24 (1): 41-50. Просмотреть аннотацию.

Kut-Lasserre, C., Miller, CC, Ejeil, AL, Gogly, B., Dridi, M., Piccardi, N., Guillou, B., Pellat, B., and Godeau, G. Эффект авокадо и неомыляемые соевые бобы на желатиназе A (MMP-2), стромелизине 1 (MMP-3) и тканевых ингибиторах матриксной металлопротеиназы (.J.Periodontol. 2001; 72 (12): 1685-1694. Просмотреть аннотацию.

Andriamanalijaona R, Benateau H, Barre PE, et al. Влияние интерлейкина-1бета на трансформирующую экспрессию бета-фактора роста и костного морфогенетического белка-2 в клетках периодонтальной связки и альвеолярной кости человека в культуре: модуляция неомыляемыми веществами авокадо и сои. J Periodontol. 2006; 77 (7): 1156-66. Просмотреть аннотацию.

Catunda IS, Vasconcelos BC, Andrade ES, Costa DF. Клинические эффекты неомыляемого экстракта авокадо-сои при артралгии и остеоартрозе височно-нижнечелюстного сустава: предварительное исследование.Int J Oral Maxillofac Surg. 2016; 45 (8): 1015-22. Просмотреть аннотацию.

Christensen R, Bartels EM, Astrup A, Bliddal H. Симптоматическая эффективность неомыляемых веществ авокадо-сои (ASU) у пациентов с остеоартритом (OA): метаанализ рандомизированных контролируемых исследований. Хрящевой артроз. 2008; 16 (4): 399-408. Просмотреть аннотацию.

Кристиансен Б.А., Бхатти С., Гоударзи Р., Эмами С. Опечатка: ответ на письмо редактору «Лечение остеоартроза с помощью неомыляемых веществ авокадо / сои».Хрящ. 2016; 7 (1): 114-5. Просмотреть аннотацию.

Кристиансен Б.А., Бхатти С., Гударзи Р., Эмами С. Лечение остеоартрита с помощью неомыляемых веществ авокадо / сои. Хрящ. 2015; 6 (1): 30-44. Просмотреть аннотацию.

Корнблатт BS. Письмо в редакцию журнала «Лечение остеоартроза неомыляемыми веществами из авокадо / сои». Хрящ. 2016; 7 (1): 112-3. Просмотреть аннотацию.

Frondoza CG. Ответ на письмо редактору, озаглавленное: «Неомыляемые вещества из авокадо / сои, ASU Expanscience, строго отличаются от нутрицевтиков, заявленных под наименованием ASU» (4365).Хрящевой артроз. 2008; 16 (12): 1590-1. Просмотреть аннотацию.

Гоударзи Р., Тейлор Дж. Ф., Язди П. Г., Педерсен Б. А.. Влияние артроцена, неомыляемого агента из авокадо / сои, на медиаторы воспаления и экспрессию генов в хондроцитах человека. FEBS Open Bio. 2017 9 января; 7 (2): 187-194. Просмотреть аннотацию.

Хенротин Ю.Е., Санчес С., Деберг М.А. и др. Неомыляемые вещества авокадо / соевые бобы увеличивают синтез аггрекана и снижают выработку катаболических и провоспалительных медиаторов хондроцитами человека при остеоартрите.J Rheumatol 2003; 30: 1825-34. Просмотреть аннотацию.

Lequesne M, Maheu E, Cadet C, Dreiser RL. Структурное влияние неомыляемых веществ авокадо / сои на потерю суставной щели при остеоартрозе тазобедренного сустава. Arthritis Rheum 2002; 47: 50-8 .. Просмотреть аннотацию.

Maheu E, Cadet C, Marty M, et al. Рандомизированное контролируемое испытание неомыляемого действия авокадо-сои (Piascledine) на модификацию структуры при остеоартрите тазобедренного сустава: исследование ERADIAS. Ann Rheum Dis. 2014; 73 (2): 376-84. Просмотреть аннотацию.

Maheu E, Mazieres B., Valat JP, et al. Симптоматическая эффективность неомыляемых веществ из авокадо / сои при лечении остеоартроза коленного и тазобедренного суставов: проспективное, рандомизированное, двойное слепое, плацебо-контролируемое, многоцентровое клиническое исследование с шестимесячным периодом лечения и двухмесячным периодом наблюдения, демонстрирующее стойкость эффект. Arthritis Rheum 1998; 41: 81-91. Просмотреть аннотацию.

Martínez-Abundis E, González-Ortiz M, Mercado-Sesma AR, Reynoso-von-Drateln C, Moreno-Andrade A.Влияние неомыляемых веществ соевых бобов авокадо на секрецию инсулина и чувствительность к инсулину у пациентов с ожирением. Факты об ожирении. 2013; 6 (5): 443-8. Просмотреть аннотацию.

Msika P, Baudouin C, Saunois A, Bauer T. Неомыляемые вещества из авокадо / сои, ASU EXPANSCIENCE, строго отличаются от нутрицевтических продуктов, заявленных под наименованием ASU. Хрящевой артроз. 2008; 16 (10): 1275-6. Просмотреть аннотацию.

Oliveira GJ, Paula LG, Souza JA, Spin-Neto R, Stavropoulos A, Marcantonio RA. Влияние неомыляемых веществ авокадо / сои на вызванную лигатурой потерю костной массы и восстановление костей после удаления лигатуры у крыс.J Periodontal Res. 2016; 51 (3): 332-41. Просмотреть аннотацию.

Oryan A, Mohammadalipour A, Moshiri A, Tabandeh MR. Неомыляемые вещества авокадо / сои: новый регулятор заживления, моделирования и ремоделирования кожных ран. Int Wound J. 2015; 12 (6): 674-85. Просмотреть аннотацию.

Панахи Ю., Бейрагдар Ф., Кашани Н., Бахари Джаван Н., Даджо Ю. Сравнение пиаскледина (масло авокадо и соевых бобов) и заместительной гормональной терапии при приливах, вызванных менопаузой. Iran J Pharm Res. 2011 осень; 10 (4): 941-51.Просмотреть аннотацию.

Pavelka K, Coste P, Géher P, Krejci G. Эффективность и безопасность пиаскледина 300 по сравнению с хондроитин сульфатом в течение 6 месяцев лечения плюс 2 месяца наблюдения у пациентов с остеоартрозом коленного сустава. Clin Rheumatol. 2010; 29 (6): 659-70. Просмотреть аннотацию.

Солиман М.Ф. Оценка неомыляемости авокадо / сои отдельно или одновременно с празиквантелом при шистосомозе мышей. Acta Trop. 2012 июн; 122 (3): 261-6. Просмотреть аннотацию.

ПРАЙМ PubMed | Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом в течение 6 месяцев лечения плюс 2 месяца наблюдения у пациентов с остеоартрозом коленного сустава

Citation

Pavelka, Karel, et al.«Эффективность и безопасность Piascledine 300 по сравнению с хондроитинсульфатом при 6-месячном лечении плюс 2-месячное наблюдение у пациентов с остеоартрозом коленного сустава». Клиническая ревматология, т. 29, нет. 6, 2010, с. 659-70.

Павелка К., Косте П., Гехер П. и др. Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом в течение 6 месяцев лечения плюс 2 месяца наблюдения у пациентов с остеоартрозом коленного сустава. Clin Rheumatol . 2010; 29 (6): 659-70.

Павелка, К., Косте П., Гехер П. и Крейчи Г. (2010). Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом в течение 6 месяцев лечения плюс 2 месяца наблюдения у пациентов с остеоартрозом коленного сустава. Клиническая ревматология , 29 (6), 659-70. https://doi.org/10.1007/s10067-010-1384-8

Павелка К. и др. Эффективность и безопасность Piascledine 300 по сравнению с хондроитинсульфатом при 6-месячном лечении плюс 2-месячное наблюдение у пациентов с остеоартрозом коленного сустава. Clin Rheumatol. 2010; 29 (6): 659-70. PubMed PMID: 20179981.

TY — JOUR T1 — Эффективность и безопасность пиаскледина 300 по сравнению с хондроитинсульфатом в течение 6 месяцев лечения плюс 2 месяца наблюдения у пациентов с остеоартрозом коленного сустава. AU — Павелка, Карел, Австралия — Кост, Филипп, AU — Гехер, Пал, AU — Крейчи, Герхард, 1 год — 2010/02/24 / PY — 2009/03/04 / получено PY — 2010/01/06 / принято PY — 2009/10/15 / исправлено PY — 2010/2/25 / entrez PY — 2010/2/25 / pubmed PY — 2010/7/22 / medline SP — 659 EP — 70 JF — Клиническая ревматология JO — Clin Rheumatol ВЛ — 29 ИС — 6 N2 — Исследовать, что 6-месячное лечение неомыляемым авокадо-соевым бобом (Пиаскледин 300 мг) один раз в день так же эффективно, как и хондроитинсульфат 400 мг три раза в день при феморотибиальном гонартрозе, а также переносимый эффект в течение еще двух месяцев сопоставим. .Пациенты были рандомизированы (1: 1) в группы лечения. Они получали в течение 6 месяцев 3 капсулы хондроитинсульфата в день или одну капсулу неомыляемого вещества соевых бобов авокадо (ASU) по методу двойной фиксации. После лечения в течение 2 месяцев определяли переходящий эффект. Первичным критерием эффективности было изменение индекса WOMAC от начала исследования до конца лечения. Вторичными критериями были изменения индекса Лекена, боль при активном движении и в покое, общая оценка эффективности.Триста шестьдесят четыре пациента приняли участие в исследовании. Триста шестьдесят один пациент имел право на оценку. Сто восемьдесят три получали ASU 300 мг один раз в день, сто семьдесят восемь хондроитинсульфат три раза в день. Индекс WOMAC снизился в обеих группах прим. 50% до конца терапии. Во время наблюдения после лечения было дальнейшее небольшое улучшение. Статистически значимой разницы между группами лечения в течение всего наблюдения не было.Все остальные наблюдаемые параметры показали ту же картину. Ежедневное потребление лекарств неотложной помощи постоянно сокращалось. Общая эффективность была оценена как отличная и хорошая более чем у 80% пациентов в обеих группах. Оба препарата безопасны и хорошо переносятся. Первое прямое сравнение неомыляемого вещества из авокадо и сои в дозе 300 мг один раз в день и хондроитинсульфата три раза в день не выявило разницы в эффективности или безопасности между 1 капсулой ASU 300 мг в день и 3 капсулами хондроитинсульфата в день.Можно предположить, что ежедневный прием ASU приведет к лучшему соблюдению режима стандартной терапии. СН — 1434-9949 UR — https://www.unboundmedicine.com/medline/citation/20179981/efficacy_and_safety_of_piascledine_300_versus_chondroitin_sulfate_in_a_6_months_treatment_plus_2_months_ob_in_patients_with_e_theoarth_ L2 — https://dx.doi.org/10.1007/s10067-010-1384-8 БД — ПРЕМЬЕР DP — Unbound Medicine ER —

Лечение пероральными травами для лечения остеоартрита

Справочная информация: что такое остеоартрит и что такое лечение травами?

Остеоартрит (ОА) — заболевание суставов (обычно колен, бедер, рук).Когда суставы теряют хрящ, кость растет, чтобы попытаться восстановить повреждение. Однако вместо того, чтобы делать вещи лучше, кость ненормально растет и ухудшает положение. Например, кость может деформироваться, вызвать болезненные ощущения в суставе и ограничить движения. ОА может повлиять на вашу физическую функцию, особенно на вашу способность использовать суставы.

Лекарственные средства растительного происхождения определяются как готовые, маркированные лекарственные препараты, содержащие в качестве активных ингредиентов надземные или подземные части растений или другой растительный материал или их комбинации, в неочищенном виде или в виде растительных препаратов (например, экстракты, масла, настойки). .

Характеристики исследования

Это краткое изложение обновленного Кокрановского обзора представляет то, что мы знаем из исследований о влиянии лечебных трав, принимаемых перорально людьми с остеоартритом. После поиска всех соответствующих исследований по август 2013 года мы включили 45 новых исследований с момента последнего обзора, в результате чего в общей сложности было 49 исследований (по 33 травяным вмешательствам), в которых участвовало 5980 участников, большинство из которых страдали симптоматическим остеоартритом коленного или тазобедренного сустава от легкой до умеренной степени.Тридцать три различных лекарственных растительных продукта сравнивали с плацебо или контролем с активным вмешательством, и во многих сравнениях проводились только единичные исследования; Таким образом, мы ограничили сообщение результатов здесь несколькими исследованиями Boswellia serrata (моно-травяной) и неомыляемых продуктов из авокадо-соевых бобов (ASU) (комбинация двух трав) .

Ключевые результаты

Босвеллия пильчатая

Боль по шкале от 0 до 100 баллов (более низкие баллы означают уменьшение боли):

— люди, которые использовали 100 мг обогащенного экстракта Boswellia serrata , оценили свою боль на 17 пунктов ниже (на 8–26 пунктов ниже) (абсолютное улучшение на 17%) через 90 дней по сравнению с плацебо;

— люди, которые использовали обогащенный экстракт Boswellia serrata 100 мг, оценили свою боль в 23 балла;

— люди, которые использовали препарат плацебо, оценили свою боль на 40 баллов.

Физическая функция по шкале от 0 до 100 баллов (чем ниже балл, тем лучше физическая функция):

— люди, которые использовали 100 мг обогащенного экстракта Boswellia serrata , оценили свою физическую функцию на 8 баллов лучше (на 2–14 баллов) по 100-балльной шкале (8% абсолютное улучшение) через 90 дней по сравнению с плацебо;

— люди, которые употребляли 100 мг обогащенного экстракта Boswellia serrata , оценили свою физическую функцию на 25 баллов;

— люди, которые использовали плацебо, оценили свою физическую функцию на 33 балла.

Неомыляемые вещества из авокадо-соевых бобов (ASU) Piascledine®

Боль по шкале от 0 до 100 баллов (более низкие баллы означают уменьшение боли):

— люди, которые использовали 300 мг ASU, оценили свою боль на 8 баллов ниже (на 1–16 баллов) по 100 балльной шкале (8% абсолютное улучшение) через 3–12 месяцев по сравнению с плацебо;

— люди, принимавшие АСУ 300 мг, оценили свою боль в 33 балла;

— люди, которые использовали плацебо, оценили свою боль в 41 балл.

Физическая функция по шкале от 0 до 100 мм (более низкие баллы означают лучшую физическую функцию):

— люди, принимавшие ASU 300 мг, оценили свою физическую функцию на 7 мм лучше (на 2–12 мм лучше) по шкале 100 мм (абсолютное улучшение на 7%) через 3–12 месяцев по сравнению с плацебо;

— люди, принимавшие АСУ 300 мг, оценили свою физическую функцию на 40 мм;

— люди, принимавшие плацебо, оценили свою физическую функцию на 47 мм.

Качество доказательств

Имеются доказательства среднего качества, что у людей с остеоартритом Boswellia serrata незначительно улучшает боль и функции.Дальнейшие исследования могут изменить оценки.

Имеются доказательства среднего качества, что неомыляемые вещества авокадо-соевые бобы (ASU), вероятно, немного уменьшают боль и улучшают функцию, но могут не сохранять суставную щель. Дальнейшие исследования могут изменить оценки.

Мы не уверены, уменьшают ли другие пероральные растительные продукты боль или функцию при остеоартрите, или замедляют прогрессирование повреждения структуры сустава, потому что доступные доказательства ограничены отдельными исследованиями или исследованиями, которые нельзя объединить, и некоторые из этих исследований имеют низкое или очень низкое качество. .Качество жизни не измерялось.

Терапия травами может вызывать побочные эффекты, однако мы не уверены в их повышенном риске.

Авокадо, соя, неомыляемая при остеоартрите

Неомыляемые вещества соевых бобов авокадо (часто называемые ASU) представляют собой натуральные растительные экстракты, изготовленные из масел авокадо и соевых бобов. Было показано, что ASU благотворно влияет на некоторые симптомы остеоартрита и может замедлить прогрессирование состояния. По данным Фонда артрита, неомыляемые вещества из авокадо и сои считаются безопасными и эффективными для людей с остеоартритом.

Добавки ASU, часто известные под торговой маркой Piascledine, доступны без рецепта (OTC) в виде капсул, которые принимают внутрь.

Маноа / Getty Images

Как работает ASU

ASU содержит одну треть авокадо и две трети неомыляемых веществ сои — компоненты липидов, которые уникальны по своему составу тем, что они не могут быть превращены в мыло. Хотя последняя часть этого определения кажется неуместной, это уникальный состав неомыляемых веществ. что считается полезным для здоровья.

Интересно, однако, что эксперты не уверены, какое конкретное химическое вещество в этой комбинации является активным ингредиентом; это также может быть химическое вещество, созданное комбинацией ингредиентов.

Эффекты ASU включают уменьшение разрушения хряща, а также содействие восстановлению хряща.

ASU уменьшает воспаление, и, в частности, было обнаружено, что он уменьшает количество воспалительных клеток и белков, которые играют роль в разрушении хряща при остеоартрите.

Что показывают исследования по ASU при артрите?

Употребление в пищу авокадо и сои, даже в больших количествах, не обеспечивает достаточного количества неомыляемых веществ, чтобы вызвать положительный эффект при остеоартрите. Лишь небольшая часть масла является неомыляемой.

Был проведен ряд исследований на людях и многих исследований на животных, в которых оценивалось влияние АСУ на остеоартрит, включая остеоартрит коленного сустава и остеоартрит тазобедренного сустава. Результаты в целом были многообещающими с точки зрения улучшения симптомов, и не было документально подтвержденных побочных эффектов. эффекты или проблемы безопасности.

Например, в ходе шестимесячного исследования оценивалось влияние АСУ на женщин с остеоартрозом височно-нижнечелюстного сустава. Во время испытания участники, которые использовали ASU, испытали уменьшение боли, улучшили качество жизни и сообщили о снижении использования обезболивающих, таких как нестероидные противовоспалительные препараты (НПВП), по сравнению с участниками, которые не использовали ASU.

Трехлетнее исследование проводилось с участием группы участников с остеоартрозом тазобедренного сустава. Группа, которая использовала ASU, имела немного меньшую потерю ширины суставной щели, чем те, кто не использовал добавку.Уменьшение ширины суставной щели измеряется с помощью визуализационных тестов и широко считается отражением обострения остеоартрита. За исследуемый период проблем с безопасностью замечено не было.

Эксперты предполагают, что использование ASU также может быть полезным при профилактическом приеме на ранних стадиях остеоартрита.

Дозировка и использование

Добавки ASU доступны в виде мягких гелей или таблеток. Рекомендуется принимать их как с пищей, так и с водой.

Рекомендуемая доза при остеоартрите составляет 300 миллиграммов (мг) в день.Никаких дополнительных преимуществ от приема более высоких доз неомыляемых веществ авокадо и соевых бобов не наблюдается.

ASU можно принимать отдельно или с другими лекарствами, используемыми для лечения остеоартрита. Комбинация ASU и глюкозамина / хондроитинсульфата широко считается безопасной и может усиливать эффекты лечения.

Может пройти не менее двух месяцев, прежде чем вы заметите какое-либо улучшение своих симптомов после начала ASU. Вы также можете почувствовать длительное облегчение симптомов в течение примерно двух месяцев после прекращения лечения.

Если вы принимаете ASU, обязательно включите его в список лекарств, которые вы сообщаете своему врачу и фармацевту. В ходе испытаний были отмечены некоторые побочные эффекты:

  • Желудочно-кишечные расстройства
  • Тошнота / рвота
  • Головные боли / мигрени

Людям с аллергией на авокадо и соевые бобы следует избегать приема добавки, также сообщалось об аллергических реакциях у людей с чувствительностью к латексу, употребляющих продукты на основе авокадо.

Хотя эта добавка не имеет других серьезных побочных эффектов, она не рекомендуется детям, беременным женщинам или людям с серьезными заболеваниями печени или почек.

Слово от Verywell

Остеоартрит — это дегенеративное заболевание, которое прогрессирует с годами, вызывая боль, дискомфорт и снижение подвижности из-за разрушения хряща. Существует ряд безрецептурных и рецептурных лекарств, пищевых добавок, упражнений, вариантов физиотерапии и мер образа жизни, которые могут помочь контролировать симптомы и замедлить прогрессирование заболевания.

В настоящее время ASU считается полезным вариантом лечения остеоартрита, но пока не ясно, будут ли преимущества продолжительными или как долго человек должен продолжать использовать добавку.

Добавить комментарий

Ваш адрес email не будет опубликован. Обязательные поля помечены *